Mutagenetix > Incidental Mutation

Incidental Mutation 'R5116:Adamts19'

394222

Institutional Source

Beutler Lab

Gene Symbol

Adamts19

Ensembl Gene

ENSMUSG00000053441

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19

Synonyms

D230034E10Rik

MMRRC Submission

042704-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5116 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58836764-59053678 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58902994 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 417 (V417A)

Ref Sequence

ENSEMBL: ENSMUSP00000050535 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052907]

AlphaFold

P59509

Predicted Effect

possibly damaging
Transcript: ENSMUST00000052907
AA Change: V417A

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: V417A

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	57	84	N/A	INTRINSIC
low complexity region	109	124	N/A	INTRINSIC
Pfam:Pep_M12B_propep	131	276	1.6e-21	PFAM
Pfam:Reprolysin_5	326	523	1.7e-13	PFAM
Pfam:Reprolysin_4	328	544	2e-10	PFAM
Pfam:Reprolysin	328	548	9e-22	PFAM
Pfam:Reprolysin_2	346	537	1.6e-9	PFAM
Pfam:Reprolysin_3	350	496	3.4e-12	PFAM
low complexity region	551	562	N/A	INTRINSIC
TSP1	639	689	5.68e-9	SMART
Pfam:ADAM_spacer1	793	903	1.1e-31	PFAM
TSP1	922	980	4.95e-2	SMART
TSP1	982	1040	4.95e-2	SMART
TSP1	1042	1086	1.62e-4	SMART
TSP1	1093	1147	1.03e-6	SMART
Pfam:PLAC	1167	1199	4.2e-9	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.5%

Validation Efficiency

97% (59/61)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	T	C	5: 124,078,867	H429R	probably damaging	Het
Adam39	G	T	8: 40,825,001	C143F	probably damaging	Het
Adcy10	C	A	1: 165,519,500	A362E	probably damaging	Het
Akap6	A	G	12: 53,141,515	E1904G	probably benign	Het
Aldh18a1	A	G	19: 40,553,505	M89T	probably benign	Het
Alyref	G	T	11: 120,597,728	F91L	probably benign	Het
Capn3	G	T	2: 120,485,292	M248I	probably benign	Het
Catsper4	A	T	4: 134,226,680	I56N	probably damaging	Het
Ccdc151	A	G	9: 21,990,128	*595Q	probably null	Het
Cckbr	T	A	7: 105,433,655	I75N	probably damaging	Het
Ccr8	T	C	9: 120,094,029	I70T	probably benign	Het
Cdh24	T	C	14: 54,636,413	D428G	probably benign	Het
Cdk5rap2	G	T	4: 70,307,238	Q557K	possibly damaging	Het
Clip1	C	T	5: 123,630,707	A610T	probably benign	Het
Dnajc16	A	T	4: 141,767,969	Y479*	probably null	Het
Fpr-rs3	A	G	17: 20,624,300	V193A	probably benign	Het
Gm29125	T	C	1: 80,383,973		noncoding transcript	Het
Hist1h1e	A	G	13: 23,622,287	Y71H	probably damaging	Het
Ifi208	A	G	1: 173,677,983		probably benign	Het
Immp1l	G	A	2: 105,965,295	R155H	probably benign	Het
Itgad	C	A	7: 128,203,893	T7K	probably damaging	Het
Itgb3	T	C	11: 104,641,077	V370A	probably benign	Het
Jak1	A	G	4: 101,155,113	I1053T	probably benign	Het
Kif21b	A	G	1: 136,152,783	R572G	probably damaging	Het
Lama2	A	T	10: 27,118,560	D1784E	probably benign	Het
Ltbp2	A	T	12: 84,809,737	V651D	probably damaging	Het
Mrpl47	A	G	3: 32,733,601	L100S	probably damaging	Het
Mx1	T	G	16: 97,457,479	N6T	possibly damaging	Het
Nde1	T	A	16: 14,183,487	M133K	probably benign	Het
Nlrc5	T	C	8: 94,481,860	L778P	probably damaging	Het
Olfr1156	G	A	2: 87,949,529	R235C	probably benign	Het
Olfr603	G	A	7: 103,383,864	T46I	probably benign	Het
Olfr803	A	G	10: 129,691,397	S215P	probably damaging	Het
Olfr850	A	G	9: 19,477,798	S151P	possibly damaging	Het
Olfr885	T	C	9: 38,061,338	V6A	probably benign	Het
Otog	T	C	7: 46,273,767	V1022A	probably benign	Het
Pcdhac1	G	A	18: 37,091,447	V438M	probably damaging	Het
Pcsk5	G	A	19: 17,463,434	S1264F	possibly damaging	Het
Pfas	T	C	11: 68,990,990		probably benign	Het
Pigr	T	A	1: 130,849,031	F648I	probably benign	Het
Pla2r1	A	C	2: 60,448,906	Y777D	probably damaging	Het
Pnpla7	G	T	2: 25,021,970	G716V	probably damaging	Het
Rab11fip5	C	T	6: 85,348,807	E206K	probably damaging	Het
S100a10	A	G	3: 93,560,940		probably null	Het
Slc35f1	T	C	10: 53,021,895	I134T	probably benign	Het
Smarcd1	C	T	15: 99,702,488	A56V	probably benign	Het
Snrk	A	G	9: 122,160,330	T247A	probably benign	Het
Srgap1	A	G	10: 121,792,379	L896P	possibly damaging	Het
Tmem19	A	T	10: 115,343,746	F167I	probably benign	Het
Tmprss11f	T	C	5: 86,539,696	S118G	probably benign	Het
Tnc	A	G	4: 63,967,215		probably null	Het
Trem3	T	C	17: 48,249,552	L17P	probably benign	Het
Upp2	A	G	2: 58,771,542	Y67C	probably damaging	Het
Zfp276	A	G	8: 123,264,977		probably benign	Het
Zfp932	T	A	5: 110,009,376	D280E	probably benign	Het

Other mutations in Adamts19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Adamts19	APN	18	59024465	missense	probably damaging	1.00
IGL00331:Adamts19	APN	18	59007325	splice site	probably benign
IGL00970:Adamts19	APN	18	59011077	missense	possibly damaging	0.82
IGL01328:Adamts19	APN	18	59048882	missense	possibly damaging	0.89
IGL01385:Adamts19	APN	18	58972779	missense	probably damaging	0.98
IGL01529:Adamts19	APN	18	58963463	missense	probably damaging	0.99
IGL01535:Adamts19	APN	18	58968819	missense	probably benign	0.00
IGL01557:Adamts19	APN	18	58968720	splice site	probably null
IGL01705:Adamts19	APN	18	59032966	missense	possibly damaging	0.91
IGL01803:Adamts19	APN	18	58952469	missense	probably damaging	1.00
IGL02116:Adamts19	APN	18	58837499	missense	probably benign
IGL02131:Adamts19	APN	18	59052660	missense	probably damaging	1.00
IGL02312:Adamts19	APN	18	58927297	missense	probably damaging	1.00
IGL02755:Adamts19	APN	18	58969933	missense	probably benign	0.25
IGL02866:Adamts19	APN	18	59048842	missense	possibly damaging	0.80
IGL02964:Adamts19	APN	18	58988965	missense	probably damaging	1.00
IGL02982:Adamts19	APN	18	59024518	missense	probably damaging	1.00
IGL03040:Adamts19	APN	18	58903008	missense	probably benign	0.05
R0081:Adamts19	UTSW	18	58903065	critical splice donor site	probably null
R0194:Adamts19	UTSW	18	59011148	missense	probably null	1.00
R0195:Adamts19	UTSW	18	58969870	splice site	probably benign
R0541:Adamts19	UTSW	18	58927300	critical splice donor site	probably null
R0659:Adamts19	UTSW	18	59007493	splice site	probably benign
R0967:Adamts19	UTSW	18	58972740	nonsense	probably null
R1512:Adamts19	UTSW	18	59048845	missense	possibly damaging	0.89
R1536:Adamts19	UTSW	18	59052615	missense	probably damaging	1.00
R1582:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R1629:Adamts19	UTSW	18	58954619	missense	probably damaging	0.97
R1653:Adamts19	UTSW	18	58890293	missense	probably benign	0.00
R1718:Adamts19	UTSW	18	58972825	missense	probably damaging	1.00
R1733:Adamts19	UTSW	18	59031929	missense	probably damaging	1.00
R1753:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R1776:Adamts19	UTSW	18	58954620	missense	probably damaging	1.00
R1905:Adamts19	UTSW	18	59032945	missense	possibly damaging	0.92
R1958:Adamts19	UTSW	18	58970006	missense	probably benign	0.09
R1994:Adamts19	UTSW	18	58972831	critical splice donor site	probably null
R2177:Adamts19	UTSW	18	58954554	missense	possibly damaging	0.66
R3730:Adamts19	UTSW	18	58900910	missense	probably damaging	1.00
R4342:Adamts19	UTSW	18	58942500	missense	probably damaging	1.00
R4772:Adamts19	UTSW	18	58837776	missense	possibly damaging	0.85
R4822:Adamts19	UTSW	18	58890284	missense	probably damaging	1.00
R4891:Adamts19	UTSW	18	59033000	missense	probably damaging	1.00
R5112:Adamts19	UTSW	18	59031804	nonsense	probably null
R5205:Adamts19	UTSW	18	58968808	missense	probably damaging	1.00
R5765:Adamts19	UTSW	18	59052582	missense	probably damaging	1.00
R5781:Adamts19	UTSW	18	58837968	missense	possibly damaging	0.59
R5792:Adamts19	UTSW	18	58837512	missense	possibly damaging	0.49
R6082:Adamts19	UTSW	18	58968774	missense	probably benign	0.18
R6088:Adamts19	UTSW	18	58902102	missense	probably damaging	1.00
R7060:Adamts19	UTSW	18	58837640	nonsense	probably null
R7251:Adamts19	UTSW	18	58837902	missense	probably damaging	1.00
R7295:Adamts19	UTSW	18	58837883	missense	probably damaging	1.00
R7974:Adamts19	UTSW	18	59011022	missense	possibly damaging	0.72
R7991:Adamts19	UTSW	18	59052654	missense	probably damaging	1.00
R8129:Adamts19	UTSW	18	59007487	critical splice donor site	probably null
R8297:Adamts19	UTSW	18	58837848	missense	probably damaging	1.00
R8336:Adamts19	UTSW	18	59007372	missense	possibly damaging	0.78
R8358:Adamts19	UTSW	18	59048809	missense	probably damaging	1.00
R8864:Adamts19	UTSW	18	58890425	nonsense	probably null
R9051:Adamts19	UTSW	18	58900976	missense	probably damaging	1.00
R9253:Adamts19	UTSW	18	58969941	missense	probably damaging	0.98
R9423:Adamts19	UTSW	18	58890355	missense	possibly damaging	0.89
R9610:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9611:Adamts19	UTSW	18	58890327	missense	probably benign	0.26
R9686:Adamts19	UTSW	18	58838021	missense	probably benign	0.00
R9697:Adamts19	UTSW	18	58968762	missense	probably damaging	0.99
R9747:Adamts19	UTSW	18	58890415	missense	possibly damaging	0.69
Z1177:Adamts19	UTSW	18	58838075	missense	probably damaging	1.00
Z1177:Adamts19	UTSW	18	58890374	missense	possibly damaging	0.47

Predicted Primers

PCR Primer
(F):5'- CATTTGGGAGGTTGCCTTAGGA -3'
(R):5'- ACAGTAAGCCTCAGAAAGATGGA -3'

Sequencing Primer
(F):5'- AGGTTGCCTTAGGATTAATGAATTG -3'
(R):5'- GGAGAAGACTAGAATCATTATTGCC -3'

Posted On

2016-06-15