Mutagenetix > Incidental Mutation

Incidental Mutation 'R5044:Npas2'

394226

Institutional Source

Beutler Lab

Gene Symbol

Npas2

Ensembl Gene

ENSMUSG00000026077

Gene Name

neuronal PAS domain protein 2

Synonyms

bHLHe9, MOP4

MMRRC Submission

042634-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5044 (G1)

Quality Score

178

Status

Validated

Chromosome

Chromosomal Location

39193731-39363236 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 39347506 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 619 (R619*)

Ref Sequence

ENSEMBL: ENSMUSP00000054719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056815]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000056815
AA Change: R619*

SMART Domains

Protein: ENSMUSP00000054719
Gene: ENSMUSG00000026077
AA Change: R619*

Domain	Start	End	E-Value	Type
HLH	15	65	6.56e-10	SMART
PAS	84	150	4.28e-10	SMART
PAS	239	305	4.03e-6	SMART
PAC	311	354	6.2e-7	SMART
low complexity region	400	419	N/A	INTRINSIC
coiled coil region	510	538	N/A	INTRINSIC
low complexity region	563	583	N/A	INTRINSIC
low complexity region	623	643	N/A	INTRINSIC
low complexity region	745	768	N/A	INTRINSIC
low complexity region	798	816	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172825

Meta Mutation Damage Score

0.9710

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

96% (73/76)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH)-PAS family of transcription factors. The encoded protein may play a regulatory role in the acquisition of specific types of memory. It also may function as a part of a molecular clock operative in the mammalian forebrain. [provided by RefSeq, Dec 2014]
PHENOTYPE: Targeted mutation of this gene results in deficits in complex emotional long-term memory tasks [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,373,323	F3387I	possibly damaging	Het
Acacb	T	A	5: 114,166,027	S170R	probably benign	Het
Adamtsl4	A	G	3: 95,681,650		probably null	Het
Adgrv1	A	G	13: 81,488,931	C3464R	probably benign	Het
Apbb1	A	T	7: 105,565,682		probably benign	Het
Cad	A	G	5: 31,055,021	T23A	probably benign	Het
Cdca7	A	G	2: 72,483,415	R183G	probably benign	Het
Cdpf1	T	C	15: 85,809,312	T5A	probably benign	Het
Cep85	T	C	4: 134,156,179	D133G	probably damaging	Het
Chrna9	T	C	5: 65,971,016	L189P	probably damaging	Het
Clca1	A	C	3: 145,007,928		probably null	Het
Cntn1	G	T	15: 92,242,995	V201F	probably damaging	Het
Col4a3	A	G	1: 82,666,546	E352G	unknown	Het
Ddhd2	T	C	8: 25,752,137	Y237C	probably damaging	Het
Dnah6	A	C	6: 73,037,622	F3609V	probably benign	Het
Epha3	T	C	16: 63,602,287	K580R	possibly damaging	Het
Fam135b	T	C	15: 71,462,711	N878S	probably benign	Het
Fam71e2	T	C	7: 4,758,661	N351D	probably benign	Het
Fbn1	T	G	2: 125,329,102	T1938P	probably damaging	Het
Foxg1	T	C	12: 49,385,186	V234A	probably damaging	Het
Glt1d1	A	T	5: 127,644,414	N55I	probably benign	Het
Gm17641	C	A	3: 68,869,474		probably benign	Het
Gm7665	A	G	18: 16,274,731		noncoding transcript	Het
Hgf	A	C	5: 16,614,894	N541T	probably benign	Het
Hipk2	G	A	6: 38,818,879	P152S	probably benign	Het
Jarid2	C	T	13: 44,906,565	L720F	probably damaging	Het
Kifc5b	A	G	17: 26,924,787	E511G	probably damaging	Het
Ldlr	G	A	9: 21,735,242	A235T	probably benign	Het
Lmln	A	G	16: 33,074,180	D231G	possibly damaging	Het
Lrp1	A	G	10: 127,567,495	C2070R	probably damaging	Het
Mbl1	A	G	14: 41,158,724	T190A	possibly damaging	Het
Mpdz	A	T	4: 81,381,697	S355T	probably benign	Het
Muc19	C	T	15: 91,888,138		noncoding transcript	Het
Mycbp2	A	C	14: 103,139,235		probably null	Het
Naa20	T	C	2: 145,915,842	S164P	probably damaging	Het
Nme4	A	T	17: 26,093,833		probably benign	Het
Nudt19	G	A	7: 35,555,746	T20I	possibly damaging	Het
Olfr1224-ps1	T	A	2: 89,156,939	K79*	probably null	Het
Olfr1447	A	G	19: 12,901,001	Y260H	probably damaging	Het
Pitpnc1	A	G	11: 107,296,228	Y90H	possibly damaging	Het
Rcor2	A	G	19: 7,269,785	T6A	probably benign	Het
Rif1	T	A	2: 52,109,928	S1131R	probably damaging	Het
Rtkn	T	A	6: 83,150,991	D377E	probably benign	Het
Rtn4rl2	T	A	2: 84,872,502	N242I	probably damaging	Het
Sbno2	G	A	10: 80,062,188	L719F	probably benign	Het
Scn11a	G	T	9: 119,819,831	D55E	probably damaging	Het
Setd1b	T	A	5: 123,151,866	I632N	unknown	Het
Spaca6	A	G	17: 17,831,196	T45A	probably benign	Het
Srpk2	A	T	5: 23,524,392	D416E	possibly damaging	Het
Sspo	A	T	6: 48,466,955		probably null	Het
Sycp1	A	T	3: 102,845,054	I804N	probably benign	Het
Tdp2	G	A	13: 24,831,826	R32Q	probably benign	Het
Tgfbr3	A	G	5: 107,136,929	V618A	possibly damaging	Het
Tmc3	C	T	7: 83,609,118	P439S	probably benign	Het
Tnxb	A	T	17: 34,717,483	D2740V	probably damaging	Het
Tspyl4	A	G	10: 34,297,937	T142A	probably benign	Het
Ttn	T	C	2: 76,880,441		probably benign	Het
Tubgcp4	T	C	2: 121,173,580	L34P	probably damaging	Het
Tubgcp6	G	T	15: 89,099,545		probably benign	Het
Unc79	T	A	12: 103,112,703	V1690E	probably benign	Het
Vps4b	T	C	1: 106,796,418		probably null	Het
Wtap	A	G	17: 12,967,638	S341P	possibly damaging	Het
Wwc1	T	C	11: 35,883,345	T363A	probably benign	Het
Zbtb8a	G	A	4: 129,360,500	T67M	probably damaging	Het
Zfp865	T	C	7: 5,034,669		probably benign	Het

Other mutations in Npas2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02560:Npas2	APN	1	39333961	splice site	probably benign
IGL02608:Npas2	APN	1	39345446	missense	probably benign	0.06
IGL02882:Npas2	APN	1	39312996	missense	probably benign	0.08
IGL02976:Npas2	APN	1	39287484	missense	probably damaging	1.00
IGL03130:Npas2	APN	1	39313028	missense	probably damaging	1.00
IGL03297:Npas2	APN	1	39292690	missense	possibly damaging	0.71
R1263:Npas2	UTSW	1	39334768	missense	possibly damaging	0.51
R1514:Npas2	UTSW	1	39311854	missense	possibly damaging	0.82
R1618:Npas2	UTSW	1	39300727	missense	probably damaging	1.00
R1620:Npas2	UTSW	1	39333912	missense	possibly damaging	0.68
R1844:Npas2	UTSW	1	39325375	missense	probably damaging	1.00
R1868:Npas2	UTSW	1	39300678	missense	probably benign	0.03
R1892:Npas2	UTSW	1	39345422	missense	probably benign	0.00
R2002:Npas2	UTSW	1	39338195	missense	probably benign	0.10
R3157:Npas2	UTSW	1	39347609	missense	possibly damaging	0.92
R3551:Npas2	UTSW	1	39287562	missense	probably benign	0.05
R4564:Npas2	UTSW	1	39287566	missense	probably damaging	1.00
R4907:Npas2	UTSW	1	39361985	missense	unknown
R5621:Npas2	UTSW	1	39359713	missense	probably benign
R5779:Npas2	UTSW	1	39287571	missense	possibly damaging	0.48
R5822:Npas2	UTSW	1	39347566	missense	probably benign	0.00
R6033:Npas2	UTSW	1	39338180	missense	probably damaging	0.99
R6033:Npas2	UTSW	1	39338180	missense	probably damaging	0.99
R6155:Npas2	UTSW	1	39287476	missense	probably damaging	1.00
R6193:Npas2	UTSW	1	39292762	missense	probably damaging	1.00
R6220:Npas2	UTSW	1	39336061	missense	probably benign	0.00
R6341:Npas2	UTSW	1	39300687	missense	probably damaging	0.98
R6656:Npas2	UTSW	1	39361948	missense	unknown
R6778:Npas2	UTSW	1	39325300	missense	possibly damaging	0.92
R6803:Npas2	UTSW	1	39336049	missense	probably benign	0.35
R7165:Npas2	UTSW	1	39292717	missense	possibly damaging	0.79
R7250:Npas2	UTSW	1	39338107	missense	probably damaging	1.00
R7268:Npas2	UTSW	1	39287577	missense	probably damaging	0.98
R7284:Npas2	UTSW	1	39324467	missense	probably benign	0.36
R7833:Npas2	UTSW	1	39326147	missense	probably damaging	1.00
R7994:Npas2	UTSW	1	39328337	missense	possibly damaging	0.86
R8013:Npas2	UTSW	1	39338065	missense	probably benign
R8054:Npas2	UTSW	1	39287571	missense	possibly damaging	0.69
R8510:Npas2	UTSW	1	39287472	missense	probably damaging	1.00
R8683:Npas2	UTSW	1	39347627	missense	probably benign	0.00
R8738:Npas2	UTSW	1	39292716	missense	possibly damaging	0.65
R8779:Npas2	UTSW	1	39338186	missense	probably damaging	0.99
R9283:Npas2	UTSW	1	39287608	missense	probably damaging	1.00
R9541:Npas2	UTSW	1	39338113	missense	possibly damaging	0.94
R9675:Npas2	UTSW	1	39325365	missense	probably damaging	1.00
Z1176:Npas2	UTSW	1	39336010	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CAGCTGGTGGGTCCTAACTTAG -3'
(R):5'- GTCCTTTCAACAGCCTAGCATC -3'

Sequencing Primer
(F):5'- CTGGTGGGTCCTAACTTAGAGGAG -3'
(R):5'- ATCATACCTGAGCTGCCGATCATG -3'

Posted On

2016-06-15