Mutagenetix > Incidental Mutation

Incidental Mutation 'R5044:Rif1'

394230

Institutional Source

Beutler Lab

Gene Symbol

Rif1

Ensembl Gene

ENSMUSG00000036202

Gene Name

replication timing regulatory factor 1

Synonyms

6530403D07Rik, 5730435J01Rik, D2Ertd145e

MMRRC Submission

042634-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5044 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52072832-52122383 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 52109928 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1131 (S1131R)

Ref Sequence

ENSEMBL: ENSMUSP00000108313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000069794
AA Change: S1131R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: S1131R

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	22	368	3.3e-78	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112693
AA Change: S1131R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: S1131R

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	18	381	1.4e-85	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125322

Predicted Effect

probably benign
Transcript: ENSMUST00000125376

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145130

Predicted Effect

probably benign
Transcript: ENSMUST00000152178

Meta Mutation Damage Score

0.1412

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

96% (73/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,373,323	F3387I	possibly damaging	Het
Acacb	T	A	5: 114,166,027	S170R	probably benign	Het
Adamtsl4	A	G	3: 95,681,650		probably null	Het
Adgrv1	A	G	13: 81,488,931	C3464R	probably benign	Het
Apbb1	A	T	7: 105,565,682		probably benign	Het
Cad	A	G	5: 31,055,021	T23A	probably benign	Het
Cdca7	A	G	2: 72,483,415	R183G	probably benign	Het
Cdpf1	T	C	15: 85,809,312	T5A	probably benign	Het
Cep85	T	C	4: 134,156,179	D133G	probably damaging	Het
Chrna9	T	C	5: 65,971,016	L189P	probably damaging	Het
Clca1	A	C	3: 145,007,928		probably null	Het
Cntn1	G	T	15: 92,242,995	V201F	probably damaging	Het
Col4a3	A	G	1: 82,666,546	E352G	unknown	Het
Ddhd2	T	C	8: 25,752,137	Y237C	probably damaging	Het
Dnah6	A	C	6: 73,037,622	F3609V	probably benign	Het
Epha3	T	C	16: 63,602,287	K580R	possibly damaging	Het
Fam135b	T	C	15: 71,462,711	N878S	probably benign	Het
Fam71e2	T	C	7: 4,758,661	N351D	probably benign	Het
Fbn1	T	G	2: 125,329,102	T1938P	probably damaging	Het
Foxg1	T	C	12: 49,385,186	V234A	probably damaging	Het
Glt1d1	A	T	5: 127,644,414	N55I	probably benign	Het
Gm17641	C	A	3: 68,869,474		probably benign	Het
Gm7665	A	G	18: 16,274,731		noncoding transcript	Het
Hgf	A	C	5: 16,614,894	N541T	probably benign	Het
Hipk2	G	A	6: 38,818,879	P152S	probably benign	Het
Jarid2	C	T	13: 44,906,565	L720F	probably damaging	Het
Kifc5b	A	G	17: 26,924,787	E511G	probably damaging	Het
Ldlr	G	A	9: 21,735,242	A235T	probably benign	Het
Lmln	A	G	16: 33,074,180	D231G	possibly damaging	Het
Lrp1	A	G	10: 127,567,495	C2070R	probably damaging	Het
Mbl1	A	G	14: 41,158,724	T190A	possibly damaging	Het
Mpdz	A	T	4: 81,381,697	S355T	probably benign	Het
Muc19	C	T	15: 91,888,138		noncoding transcript	Het
Mycbp2	A	C	14: 103,139,235		probably null	Het
Naa20	T	C	2: 145,915,842	S164P	probably damaging	Het
Nme4	A	T	17: 26,093,833		probably benign	Het
Npas2	A	T	1: 39,347,506	R619*	probably null	Het
Nudt19	G	A	7: 35,555,746	T20I	possibly damaging	Het
Olfr1224-ps1	T	A	2: 89,156,939	K79*	probably null	Het
Olfr1447	A	G	19: 12,901,001	Y260H	probably damaging	Het
Pitpnc1	A	G	11: 107,296,228	Y90H	possibly damaging	Het
Rcor2	A	G	19: 7,269,785	T6A	probably benign	Het
Rtkn	T	A	6: 83,150,991	D377E	probably benign	Het
Rtn4rl2	T	A	2: 84,872,502	N242I	probably damaging	Het
Sbno2	G	A	10: 80,062,188	L719F	probably benign	Het
Scn11a	G	T	9: 119,819,831	D55E	probably damaging	Het
Setd1b	T	A	5: 123,151,866	I632N	unknown	Het
Spaca6	A	G	17: 17,831,196	T45A	probably benign	Het
Srpk2	A	T	5: 23,524,392	D416E	possibly damaging	Het
Sspo	A	T	6: 48,466,955		probably null	Het
Sycp1	A	T	3: 102,845,054	I804N	probably benign	Het
Tdp2	G	A	13: 24,831,826	R32Q	probably benign	Het
Tgfbr3	A	G	5: 107,136,929	V618A	possibly damaging	Het
Tmc3	C	T	7: 83,609,118	P439S	probably benign	Het
Tnxb	A	T	17: 34,717,483	D2740V	probably damaging	Het
Tspyl4	A	G	10: 34,297,937	T142A	probably benign	Het
Ttn	T	C	2: 76,880,441		probably benign	Het
Tubgcp4	T	C	2: 121,173,580	L34P	probably damaging	Het
Tubgcp6	G	T	15: 89,099,545		probably benign	Het
Unc79	T	A	12: 103,112,703	V1690E	probably benign	Het
Vps4b	T	C	1: 106,796,418		probably null	Het
Wtap	A	G	17: 12,967,638	S341P	possibly damaging	Het
Wwc1	T	C	11: 35,883,345	T363A	probably benign	Het
Zbtb8a	G	A	4: 129,360,500	T67M	probably damaging	Het
Zfp865	T	C	7: 5,034,669		probably benign	Het

Other mutations in Rif1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Rif1	APN	2	52121007	missense	probably damaging	0.96
IGL00711:Rif1	APN	2	52111070	missense	probably benign	0.00
IGL00721:Rif1	APN	2	52119117	missense	probably damaging	1.00
IGL01085:Rif1	APN	2	52085140	missense	possibly damaging	0.71
IGL01093:Rif1	APN	2	52095948	missense	probably damaging	1.00
IGL01107:Rif1	APN	2	52111303	missense	probably benign	0.00
IGL01138:Rif1	APN	2	52111522	missense	probably damaging	1.00
IGL01844:Rif1	APN	2	52112543	missense	probably benign	0.07
IGL02441:Rif1	APN	2	52105515	missense	probably benign	0.00
IGL02448:Rif1	APN	2	52116696	missense	probably damaging	0.99
IGL02563:Rif1	APN	2	52077065	missense	probably damaging	1.00
IGL02704:Rif1	APN	2	52093576	missense	probably damaging	1.00
IGL02946:Rif1	APN	2	52110125	nonsense	probably null
IGL03060:Rif1	APN	2	52112137	missense	probably damaging	0.97
IGL03206:Rif1	APN	2	52103622	missense	probably damaging	1.00
IGL03263:Rif1	APN	2	52090261	missense	probably damaging	0.99
IGL03267:Rif1	APN	2	52076988	missense	possibly damaging	0.94
IGL03280:Rif1	APN	2	52112599	missense	probably benign	0.32
hifi	UTSW	2	52110324	unclassified	probably benign
nietzsche	UTSW	2	52077020	missense	probably benign	0.08
PIT4305001:Rif1	UTSW	2	52111958	missense
R0017:Rif1	UTSW	2	52116674	missense	probably benign	0.18
R0017:Rif1	UTSW	2	52116674	missense	probably benign	0.18
R0060:Rif1	UTSW	2	52111117	missense	probably damaging	1.00
R0060:Rif1	UTSW	2	52111117	missense	probably damaging	1.00
R0104:Rif1	UTSW	2	52110092	missense	possibly damaging	0.77
R0268:Rif1	UTSW	2	52090286	critical splice donor site	probably null
R0276:Rif1	UTSW	2	52110324	unclassified	probably benign
R0278:Rif1	UTSW	2	52110324	unclassified	probably benign
R0288:Rif1	UTSW	2	52110013	missense	probably damaging	1.00
R0314:Rif1	UTSW	2	52110324	unclassified	probably benign
R0345:Rif1	UTSW	2	52110324	unclassified	probably benign
R0346:Rif1	UTSW	2	52110324	unclassified	probably benign
R0383:Rif1	UTSW	2	52085141	missense	probably damaging	0.96
R0384:Rif1	UTSW	2	52110324	unclassified	probably benign
R0387:Rif1	UTSW	2	52110324	unclassified	probably benign
R0388:Rif1	UTSW	2	52110324	unclassified	probably benign
R0456:Rif1	UTSW	2	52110324	unclassified	probably benign
R0477:Rif1	UTSW	2	52110324	unclassified	probably benign
R0505:Rif1	UTSW	2	52110737	missense	probably damaging	0.99
R0510:Rif1	UTSW	2	52110324	unclassified	probably benign
R0511:Rif1	UTSW	2	52110324	unclassified	probably benign
R0512:Rif1	UTSW	2	52110324	unclassified	probably benign
R0633:Rif1	UTSW	2	52112563	missense	probably benign	0.00
R0637:Rif1	UTSW	2	52110324	unclassified	probably benign
R0638:Rif1	UTSW	2	52111588	missense	probably benign	0.12
R0666:Rif1	UTSW	2	52110324	unclassified	probably benign
R0675:Rif1	UTSW	2	52110324	unclassified	probably benign
R0707:Rif1	UTSW	2	52110324	unclassified	probably benign
R0726:Rif1	UTSW	2	52110353	missense	possibly damaging	0.52
R0743:Rif1	UTSW	2	52110324	unclassified	probably benign
R0744:Rif1	UTSW	2	52110324	unclassified	probably benign
R0938:Rif1	UTSW	2	52110324	unclassified	probably benign
R0939:Rif1	UTSW	2	52110324	unclassified	probably benign
R0940:Rif1	UTSW	2	52110324	unclassified	probably benign
R0941:Rif1	UTSW	2	52110324	unclassified	probably benign
R0942:Rif1	UTSW	2	52110324	unclassified	probably benign
R0943:Rif1	UTSW	2	52110324	unclassified	probably benign
R1006:Rif1	UTSW	2	52085029	missense	probably damaging	0.99
R1052:Rif1	UTSW	2	52111562	missense	probably benign	0.01
R1061:Rif1	UTSW	2	52110324	unclassified	probably benign
R1175:Rif1	UTSW	2	52107628	unclassified	probably benign
R1183:Rif1	UTSW	2	52110324	unclassified	probably benign
R1184:Rif1	UTSW	2	52110324	unclassified	probably benign
R1271:Rif1	UTSW	2	52110324	unclassified	probably benign
R1332:Rif1	UTSW	2	52078314	missense	probably benign	0.06
R1336:Rif1	UTSW	2	52078314	missense	probably benign	0.06
R1351:Rif1	UTSW	2	52111555	missense	possibly damaging	0.74
R1517:Rif1	UTSW	2	52110324	unclassified	probably benign
R1527:Rif1	UTSW	2	52110324	unclassified	probably benign
R1560:Rif1	UTSW	2	52111131	missense	probably damaging	1.00
R1563:Rif1	UTSW	2	52073223	missense	probably damaging	0.99
R1571:Rif1	UTSW	2	52110324	unclassified	probably benign
R1625:Rif1	UTSW	2	52103640	missense	probably benign	0.25
R1679:Rif1	UTSW	2	52110324	unclassified	probably benign
R1689:Rif1	UTSW	2	52110324	unclassified	probably benign
R1731:Rif1	UTSW	2	52110324	unclassified	probably benign
R1744:Rif1	UTSW	2	52112392	missense	possibly damaging	0.56
R1746:Rif1	UTSW	2	52110324	unclassified	probably benign
R1748:Rif1	UTSW	2	52110324	unclassified	probably benign
R1831:Rif1	UTSW	2	52078495	nonsense	probably null
R1902:Rif1	UTSW	2	52116673	missense	possibly damaging	0.93
R1964:Rif1	UTSW	2	52098409	missense	probably benign	0.01
R1978:Rif1	UTSW	2	52110324	unclassified	probably benign
R2000:Rif1	UTSW	2	52081298	missense	probably damaging	0.99
R2030:Rif1	UTSW	2	52092346	missense	probably damaging	1.00
R2056:Rif1	UTSW	2	52093576	missense	probably damaging	1.00
R2106:Rif1	UTSW	2	52110324	unclassified	probably benign
R2109:Rif1	UTSW	2	52110324	unclassified	probably benign
R2125:Rif1	UTSW	2	52110324	unclassified	probably benign
R2126:Rif1	UTSW	2	52110324	unclassified	probably benign
R2145:Rif1	UTSW	2	52111400	missense	possibly damaging	0.63
R2152:Rif1	UTSW	2	52110324	unclassified	probably benign
R2153:Rif1	UTSW	2	52110324	unclassified	probably benign
R2213:Rif1	UTSW	2	52110324	unclassified	probably benign
R2327:Rif1	UTSW	2	52110324	unclassified	probably benign
R2512:Rif1	UTSW	2	52110324	unclassified	probably benign
R2513:Rif1	UTSW	2	52110324	unclassified	probably benign
R2516:Rif1	UTSW	2	52110324	unclassified	probably benign
R2520:Rif1	UTSW	2	52110324	unclassified	probably benign
R2905:Rif1	UTSW	2	52098504	missense	probably damaging	0.99
R3005:Rif1	UTSW	2	52082764	missense	probably damaging	1.00
R3155:Rif1	UTSW	2	52110324	unclassified	probably benign
R3156:Rif1	UTSW	2	52110324	unclassified	probably benign
R3429:Rif1	UTSW	2	52110324	unclassified	probably benign
R3707:Rif1	UTSW	2	52093580	missense	probably damaging	1.00
R3907:Rif1	UTSW	2	52112545	missense	probably benign	0.03
R3978:Rif1	UTSW	2	52116747	critical splice donor site	probably null
R4023:Rif1	UTSW	2	52121087	missense	probably benign	0.01
R4052:Rif1	UTSW	2	52098471	nonsense	probably null
R4668:Rif1	UTSW	2	52111952	missense	probably benign	0.01
R4674:Rif1	UTSW	2	52106942	missense	probably null	1.00
R4715:Rif1	UTSW	2	52073139	utr 5 prime	probably benign
R4766:Rif1	UTSW	2	52098934	missense	probably damaging	1.00
R4783:Rif1	UTSW	2	52112747	missense	probably damaging	0.96
R4785:Rif1	UTSW	2	52112747	missense	probably damaging	0.96
R4869:Rif1	UTSW	2	52093611	intron	probably benign
R4911:Rif1	UTSW	2	52110518	missense	probably damaging	0.98
R4951:Rif1	UTSW	2	52084986	splice site	probably null
R5088:Rif1	UTSW	2	52092295	missense	possibly damaging	0.91
R5151:Rif1	UTSW	2	52120309	missense	probably damaging	1.00
R5187:Rif1	UTSW	2	52081289	missense	probably damaging	1.00
R5222:Rif1	UTSW	2	52077020	missense	probably benign	0.08
R5243:Rif1	UTSW	2	52111824	missense	possibly damaging	0.86
R5436:Rif1	UTSW	2	52120971	intron	probably benign
R5476:Rif1	UTSW	2	52089595	missense	probably damaging	1.00
R5496:Rif1	UTSW	2	52098916	missense	probably damaging	1.00
R5641:Rif1	UTSW	2	52121158	missense	possibly damaging	0.80
R5883:Rif1	UTSW	2	52105639	critical splice donor site	probably null
R5987:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R5990:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R5992:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6019:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6020:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6255:Rif1	UTSW	2	52085053	missense	probably damaging	1.00
R6342:Rif1	UTSW	2	52119156	missense	probably damaging	0.97
R6364:Rif1	UTSW	2	52107669	missense	probably damaging	0.97
R6747:Rif1	UTSW	2	52078263	splice site	probably null
R6928:Rif1	UTSW	2	52095961	missense	probably damaging	1.00
R6954:Rif1	UTSW	2	52112691	missense	probably benign	0.00
R7003:Rif1	UTSW	2	52076989	missense	probably benign	0.06
R7310:Rif1	UTSW	2	52105619	missense	probably benign	0.12
R7549:Rif1	UTSW	2	52078507	missense	possibly damaging	0.52
R7603:Rif1	UTSW	2	52076175	missense	probably damaging	1.00
R7673:Rif1	UTSW	2	52088654	missense	probably damaging	1.00
R7741:Rif1	UTSW	2	52085141	missense	probably damaging	0.96
R7777:Rif1	UTSW	2	52116356	missense	probably benign	0.00
R7910:Rif1	UTSW	2	52078387	nonsense	probably null
R7962:Rif1	UTSW	2	52074276	missense	probably damaging	1.00
R8264:Rif1	UTSW	2	52090278	missense	noncoding transcript
R8390:Rif1	UTSW	2	52110923	missense	probably damaging	1.00
R8479:Rif1	UTSW	2	52112551	missense	possibly damaging	0.52
R8490:Rif1	UTSW	2	52110999	missense	probably damaging	0.96
R8762:Rif1	UTSW	2	52111730	missense
R8785:Rif1	UTSW	2	52110481	missense	probably benign	0.06
R8890:Rif1	UTSW	2	52098863	missense	probably damaging	0.99
R9081:Rif1	UTSW	2	52110977	missense	probably damaging	0.99
R9225:Rif1	UTSW	2	52111850	missense	probably benign	0.22
R9284:Rif1	UTSW	2	52108552	missense	probably benign	0.00
R9300:Rif1	UTSW	2	52111139	missense	probably damaging	1.00
R9366:Rif1	UTSW	2	52120344	missense
R9477:Rif1	UTSW	2	52111330	missense	probably benign	0.02
R9522:Rif1	UTSW	2	52081299	missense	probably damaging	1.00
R9573:Rif1	UTSW	2	52110454	missense	probably benign	0.29
R9630:Rif1	UTSW	2	52089595	missense	probably damaging	1.00
X0064:Rif1	UTSW	2	52074315	missense	probably benign	0.00
X0064:Rif1	UTSW	2	52094633	missense	probably damaging	0.96
Z1177:Rif1	UTSW	2	52088648	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGGCTTTAACTGCATCATCAG -3'
(R):5'- TGCTGACCACCGAAGTTTCTG -3'

Sequencing Primer
(F):5'- AAGTATGGTAACCGTTCTTTACTGG -3'
(R):5'- GACCACCGAAGTTTCTGTACTAG -3'

Posted On

2016-06-15