Incidental Mutation 'R5044:Clca1'
ID 394241
Institutional Source Beutler Lab
Gene Symbol Clca1
Ensembl Gene ENSMUSG00000028255
Gene Name chloride channel accessory 1
Synonyms gob-5, gob5, Clca3
MMRRC Submission 042634-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R5044 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 145003817-145032776 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to C at 145007928 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029919] [ENSMUST00000029919]
AlphaFold Q9D7Z6
Predicted Effect probably null
Transcript: ENSMUST00000029919
SMART Domains Protein: ENSMUSP00000029919
Gene: ENSMUSG00000028255

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
VWA 305 478 5.05e-19 SMART
Blast:FN3 753 852 2e-28 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000029919
SMART Domains Protein: ENSMUSP00000029919
Gene: ENSMUSG00000028255

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
VWA 305 478 5.05e-19 SMART
Blast:FN3 753 852 2e-28 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195901
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium sensitive chloride conductance protein family. To date, all members of this gene family map to the same region on chromosome 1p31-p22 and share a high degree of homology in size, sequence, and predicted structure, but differ significantly in their tissue distributions. The encoded protein is expressed as a precursor protein that is processed into two cell-surface-associated subunits, although the site at which the precursor is cleaved has not been precisely determined. The encoded protein may be involved in mediating calcium-activated chloride conductance in the intestine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit an exacerbated mucin response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,323 F3387I possibly damaging Het
Acacb T A 5: 114,166,027 S170R probably benign Het
Adamtsl4 A G 3: 95,681,650 probably null Het
Adgrv1 A G 13: 81,488,931 C3464R probably benign Het
Apbb1 A T 7: 105,565,682 probably benign Het
Cad A G 5: 31,055,021 T23A probably benign Het
Cdca7 A G 2: 72,483,415 R183G probably benign Het
Cdpf1 T C 15: 85,809,312 T5A probably benign Het
Cep85 T C 4: 134,156,179 D133G probably damaging Het
Chrna9 T C 5: 65,971,016 L189P probably damaging Het
Cntn1 G T 15: 92,242,995 V201F probably damaging Het
Col4a3 A G 1: 82,666,546 E352G unknown Het
Ddhd2 T C 8: 25,752,137 Y237C probably damaging Het
Dnah6 A C 6: 73,037,622 F3609V probably benign Het
Epha3 T C 16: 63,602,287 K580R possibly damaging Het
Fam135b T C 15: 71,462,711 N878S probably benign Het
Fam71e2 T C 7: 4,758,661 N351D probably benign Het
Fbn1 T G 2: 125,329,102 T1938P probably damaging Het
Foxg1 T C 12: 49,385,186 V234A probably damaging Het
Glt1d1 A T 5: 127,644,414 N55I probably benign Het
Gm17641 C A 3: 68,869,474 probably benign Het
Gm7665 A G 18: 16,274,731 noncoding transcript Het
Hgf A C 5: 16,614,894 N541T probably benign Het
Hipk2 G A 6: 38,818,879 P152S probably benign Het
Jarid2 C T 13: 44,906,565 L720F probably damaging Het
Kifc5b A G 17: 26,924,787 E511G probably damaging Het
Ldlr G A 9: 21,735,242 A235T probably benign Het
Lmln A G 16: 33,074,180 D231G possibly damaging Het
Lrp1 A G 10: 127,567,495 C2070R probably damaging Het
Mbl1 A G 14: 41,158,724 T190A possibly damaging Het
Mpdz A T 4: 81,381,697 S355T probably benign Het
Muc19 C T 15: 91,888,138 noncoding transcript Het
Mycbp2 A C 14: 103,139,235 probably null Het
Naa20 T C 2: 145,915,842 S164P probably damaging Het
Nme4 A T 17: 26,093,833 probably benign Het
Npas2 A T 1: 39,347,506 R619* probably null Het
Nudt19 G A 7: 35,555,746 T20I possibly damaging Het
Olfr1224-ps1 T A 2: 89,156,939 K79* probably null Het
Olfr1447 A G 19: 12,901,001 Y260H probably damaging Het
Pitpnc1 A G 11: 107,296,228 Y90H possibly damaging Het
Rcor2 A G 19: 7,269,785 T6A probably benign Het
Rif1 T A 2: 52,109,928 S1131R probably damaging Het
Rtkn T A 6: 83,150,991 D377E probably benign Het
Rtn4rl2 T A 2: 84,872,502 N242I probably damaging Het
Sbno2 G A 10: 80,062,188 L719F probably benign Het
Scn11a G T 9: 119,819,831 D55E probably damaging Het
Setd1b T A 5: 123,151,866 I632N unknown Het
Spaca6 A G 17: 17,831,196 T45A probably benign Het
Srpk2 A T 5: 23,524,392 D416E possibly damaging Het
Sspo A T 6: 48,466,955 probably null Het
Sycp1 A T 3: 102,845,054 I804N probably benign Het
Tdp2 G A 13: 24,831,826 R32Q probably benign Het
Tgfbr3 A G 5: 107,136,929 V618A possibly damaging Het
Tmc3 C T 7: 83,609,118 P439S probably benign Het
Tnxb A T 17: 34,717,483 D2740V probably damaging Het
Tspyl4 A G 10: 34,297,937 T142A probably benign Het
Ttn T C 2: 76,880,441 probably benign Het
Tubgcp4 T C 2: 121,173,580 L34P probably damaging Het
Tubgcp6 G T 15: 89,099,545 probably benign Het
Unc79 T A 12: 103,112,703 V1690E probably benign Het
Vps4b T C 1: 106,796,418 probably null Het
Wtap A G 17: 12,967,638 S341P possibly damaging Het
Wwc1 T C 11: 35,883,345 T363A probably benign Het
Zbtb8a G A 4: 129,360,500 T67M probably damaging Het
Zfp865 T C 7: 5,034,669 probably benign Het
Other mutations in Clca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Clca1 APN 3 145027899 missense probably benign 0.01
IGL00862:Clca1 APN 3 145024571 missense possibly damaging 0.89
IGL00895:Clca1 APN 3 145024596 missense probably damaging 1.00
IGL00969:Clca1 APN 3 145008958 missense possibly damaging 0.80
IGL01398:Clca1 APN 3 145016751 missense possibly damaging 0.81
IGL01447:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01455:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01457:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01458:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01462:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01473:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01488:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01490:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01632:Clca1 APN 3 145027441 missense probably damaging 1.00
IGL01896:Clca1 APN 3 145015677 missense possibly damaging 0.79
IGL02411:Clca1 APN 3 145028002 missense possibly damaging 0.89
IGL03156:Clca1 APN 3 145013911 missense probably damaging 1.00
R0472:Clca1 UTSW 3 145027345 missense probably damaging 1.00
R0571:Clca1 UTSW 3 145007789 missense probably damaging 1.00
R0585:Clca1 UTSW 3 145032625 missense probably benign 0.16
R0586:Clca1 UTSW 3 145032589 missense probably benign 0.45
R0791:Clca1 UTSW 3 145004854 missense probably benign 0.01
R1187:Clca1 UTSW 3 145009743 missense probably benign 0.30
R1713:Clca1 UTSW 3 145024546 missense probably benign 0.00
R1739:Clca1 UTSW 3 145007778 missense probably benign 0.00
R2079:Clca1 UTSW 3 145007773 missense possibly damaging 0.80
R2129:Clca1 UTSW 3 145016765 missense probably damaging 1.00
R2178:Clca1 UTSW 3 145006102 missense probably damaging 1.00
R2234:Clca1 UTSW 3 145009068 missense possibly damaging 0.93
R2235:Clca1 UTSW 3 145009068 missense possibly damaging 0.93
R2240:Clca1 UTSW 3 145008985 missense probably damaging 1.00
R3751:Clca1 UTSW 3 145018663 missense probably benign 0.01
R3974:Clca1 UTSW 3 145032639 missense probably damaging 1.00
R3975:Clca1 UTSW 3 145032639 missense probably damaging 1.00
R4409:Clca1 UTSW 3 145006027 missense probably damaging 1.00
R4586:Clca1 UTSW 3 145016858 missense probably damaging 1.00
R4751:Clca1 UTSW 3 145004848 missense possibly damaging 0.89
R4894:Clca1 UTSW 3 145013901 missense probably damaging 0.99
R4909:Clca1 UTSW 3 145024563 missense probably damaging 1.00
R4916:Clca1 UTSW 3 145015844 missense probably benign 0.01
R4941:Clca1 UTSW 3 145015653 missense probably damaging 1.00
R4942:Clca1 UTSW 3 145004763 missense probably benign 0.02
R5451:Clca1 UTSW 3 145027986 missense probably damaging 1.00
R5618:Clca1 UTSW 3 145004977 missense probably benign 0.00
R5724:Clca1 UTSW 3 145009072 missense probably benign 0.01
R5898:Clca1 UTSW 3 145016761 missense possibly damaging 0.89
R6238:Clca1 UTSW 3 145008955 missense probably benign 0.09
R6590:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6591:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6592:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6690:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6691:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6729:Clca1 UTSW 3 145005966 missense probably damaging 1.00
R6805:Clca1 UTSW 3 145018667 missense probably damaging 1.00
R7106:Clca1 UTSW 3 145027429 missense probably damaging 0.98
R7121:Clca1 UTSW 3 145011806 missense probably damaging 1.00
R7127:Clca1 UTSW 3 145006045 missense probably damaging 1.00
R7212:Clca1 UTSW 3 145005966 missense probably damaging 1.00
R7444:Clca1 UTSW 3 145027432 missense probably damaging 1.00
R7446:Clca1 UTSW 3 145027427 missense possibly damaging 0.65
R7535:Clca1 UTSW 3 145018567 missense probably damaging 0.99
R8437:Clca1 UTSW 3 145005061 missense probably benign 0.00
R8474:Clca1 UTSW 3 145005031 missense possibly damaging 0.77
R8766:Clca1 UTSW 3 145009178 splice site probably benign
R8884:Clca1 UTSW 3 145013996 missense probably benign 0.35
R9049:Clca1 UTSW 3 145027382 missense probably benign 0.01
R9306:Clca1 UTSW 3 145024578 missense probably damaging 1.00
R9623:Clca1 UTSW 3 145013937 missense probably benign 0.03
X0020:Clca1 UTSW 3 145032660 missense possibly damaging 0.89
Z1176:Clca1 UTSW 3 145013921 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCCAAGCCGTTCAGTCTTC -3'
(R):5'- CAGTTCAGGGTGAGACGATTTAC -3'

Sequencing Primer
(F):5'- AAGCCGTTCAGTCTTCCCTTTAG -3'
(R):5'- TCAGGGTGAGACGATTTACATATAAG -3'
Posted On 2016-06-15