Incidental Mutation 'R5044:Srpk2'
ID394245
Institutional Source Beutler Lab
Gene Symbol Srpk2
Ensembl Gene ENSMUSG00000062604
Gene Nameserine/arginine-rich protein specific kinase 2
SynonymsWBP6, mSRPK2
MMRRC Submission 042634-MU
Accession Numbers

NCBI RefSeq: NM_009274.2; MGI:1201408

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5044 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location23503264-23684617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23524392 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 416 (D416E)
Ref Sequence ENSEMBL: ENSMUSP00000085734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088392] [ENSMUST00000196388] [ENSMUST00000196929]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088392
AA Change: D416E

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000085734
Gene: ENSMUSG00000062604
AA Change: D416E

DomainStartEndE-ValueType
low complexity region 5 46 N/A INTRINSIC
Pfam:Pkinase 79 228 1.3e-22 PFAM
Pfam:Pkinase_Tyr 79 228 1e-9 PFAM
coiled coil region 263 314 N/A INTRINSIC
coiled coil region 339 373 N/A INTRINSIC
low complexity region 393 406 N/A INTRINSIC
Pfam:Pkinase 506 680 1.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196388
SMART Domains Protein: ENSMUSP00000143453
Gene: ENSMUSG00000062604

DomainStartEndE-ValueType
S_TKc 3 129 7.2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196929
SMART Domains Protein: ENSMUSP00000143216
Gene: ENSMUSG00000062604

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 131 2.6e-8 PFAM
Pfam:Pkinase 2 130 2.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200173
Meta Mutation Damage Score 0.0958 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (73/76)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(39) : Targeted(3) Gene trapped(36)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,323 F3387I possibly damaging Het
Acacb T A 5: 114,166,027 S170R probably benign Het
Adamtsl4 A G 3: 95,681,650 probably null Het
Adgrv1 A G 13: 81,488,931 C3464R probably benign Het
Apbb1 A T 7: 105,565,682 probably benign Het
Cad A G 5: 31,055,021 T23A probably benign Het
Cdca7 A G 2: 72,483,415 R183G probably benign Het
Cdpf1 T C 15: 85,809,312 T5A probably benign Het
Cep85 T C 4: 134,156,179 D133G probably damaging Het
Chrna9 T C 5: 65,971,016 L189P probably damaging Het
Clca1 A C 3: 145,007,928 probably null Het
Cntn1 G T 15: 92,242,995 V201F probably damaging Het
Col4a3 A G 1: 82,666,546 E352G unknown Het
Ddhd2 T C 8: 25,752,137 Y237C probably damaging Het
Dnah6 A C 6: 73,037,622 F3609V probably benign Het
Epha3 T C 16: 63,602,287 K580R possibly damaging Het
Fam135b T C 15: 71,462,711 N878S probably benign Het
Fam71e2 T C 7: 4,758,661 N351D probably benign Het
Fbn1 T G 2: 125,329,102 T1938P probably damaging Het
Foxg1 T C 12: 49,385,186 V234A probably damaging Het
Glt1d1 A T 5: 127,644,414 N55I probably benign Het
Gm17641 C A 3: 68,869,474 probably benign Het
Gm7665 A G 18: 16,274,731 noncoding transcript Het
Hgf A C 5: 16,614,894 N541T probably benign Het
Hipk2 G A 6: 38,818,879 P152S probably benign Het
Jarid2 C T 13: 44,906,565 L720F probably damaging Het
Kifc5b A G 17: 26,924,787 E511G probably damaging Het
Ldlr G A 9: 21,735,242 A235T probably benign Het
Lmln A G 16: 33,074,180 D231G possibly damaging Het
Lrp1 A G 10: 127,567,495 C2070R probably damaging Het
Mbl1 A G 14: 41,158,724 T190A possibly damaging Het
Mpdz A T 4: 81,381,697 S355T probably benign Het
Muc19 C T 15: 91,888,138 noncoding transcript Het
Mycbp2 A C 14: 103,139,235 probably null Het
Naa20 T C 2: 145,915,842 S164P probably damaging Het
Nme4 A T 17: 26,093,833 probably benign Het
Npas2 A T 1: 39,347,506 R619* probably null Het
Nudt19 G A 7: 35,555,746 T20I possibly damaging Het
Olfr1224-ps1 T A 2: 89,156,939 K79* probably null Het
Olfr1447 A G 19: 12,901,001 Y260H probably damaging Het
Pitpnc1 A G 11: 107,296,228 Y90H possibly damaging Het
Rcor2 A G 19: 7,269,785 T6A probably benign Het
Rif1 T A 2: 52,109,928 S1131R probably damaging Het
Rtkn T A 6: 83,150,991 D377E probably benign Het
Rtn4rl2 T A 2: 84,872,502 N242I probably damaging Het
Sbno2 G A 10: 80,062,188 L719F probably benign Het
Scn11a G T 9: 119,819,831 D55E probably damaging Het
Setd1b T A 5: 123,151,866 I632N unknown Het
Spaca6 A G 17: 17,831,196 T45A probably benign Het
Sspo A T 6: 48,466,955 probably null Het
Sycp1 A T 3: 102,845,054 I804N probably benign Het
Tdp2 G A 13: 24,831,826 R32Q probably benign Het
Tgfbr3 A G 5: 107,136,929 V618A possibly damaging Het
Tmc3 C T 7: 83,609,118 P439S probably benign Het
Tnxb A T 17: 34,717,483 D2740V probably damaging Het
Tspyl4 A G 10: 34,297,937 T142A probably benign Het
Ttn T C 2: 76,880,441 probably benign Het
Tubgcp4 T C 2: 121,173,580 L34P probably damaging Het
Tubgcp6 G T 15: 89,099,545 probably benign Het
Unc79 T A 12: 103,112,703 V1690E probably benign Het
Vps4b T C 1: 106,796,418 probably null Het
Wtap A G 17: 12,967,638 S341P possibly damaging Het
Wwc1 T C 11: 35,883,345 T363A probably benign Het
Zbtb8a G A 4: 129,360,500 T67M probably damaging Het
Zfp865 T C 7: 5,034,669 probably benign Het
Other mutations in Srpk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Srpk2 APN 5 23540379 missense probably benign 0.10
IGL02057:Srpk2 APN 5 23518707 missense probably damaging 0.99
IGL02217:Srpk2 APN 5 23545570 missense probably damaging 1.00
IGL03115:Srpk2 APN 5 23524618 splice site probably null
FR4737:Srpk2 UTSW 5 23545196 unclassified probably null
P0008:Srpk2 UTSW 5 23513978 missense probably damaging 1.00
R0142:Srpk2 UTSW 5 23527930 missense probably damaging 0.97
R0462:Srpk2 UTSW 5 23518426 missense probably damaging 1.00
R0992:Srpk2 UTSW 5 23545543 missense probably damaging 0.99
R1569:Srpk2 UTSW 5 23514026 missense probably damaging 1.00
R1677:Srpk2 UTSW 5 23525750 splice site probably null
R1696:Srpk2 UTSW 5 23548494 nonsense probably null
R1752:Srpk2 UTSW 5 23528019 missense probably damaging 1.00
R1862:Srpk2 UTSW 5 23524150 missense probably benign 0.32
R1989:Srpk2 UTSW 5 23518423 missense probably damaging 1.00
R2173:Srpk2 UTSW 5 23518615 splice site probably null
R4096:Srpk2 UTSW 5 23540502 intron probably benign
R4271:Srpk2 UTSW 5 23548515 missense possibly damaging 0.95
R4894:Srpk2 UTSW 5 23545529 missense probably damaging 1.00
R5043:Srpk2 UTSW 5 23524517 missense probably benign
R5309:Srpk2 UTSW 5 23525718 missense probably damaging 0.97
R5478:Srpk2 UTSW 5 23524183 missense possibly damaging 0.71
R5568:Srpk2 UTSW 5 23525699 missense possibly damaging 0.73
R5665:Srpk2 UTSW 5 23518477 missense probably damaging 0.99
R5678:Srpk2 UTSW 5 23524606 frame shift probably null
R6364:Srpk2 UTSW 5 23540467 missense probably damaging 1.00
R7201:Srpk2 UTSW 5 23507628 missense possibly damaging 0.64
R7597:Srpk2 UTSW 5 23548519 missense possibly damaging 0.96
RF035:Srpk2 UTSW 5 23525575 utr 3 prime probably benign
RF042:Srpk2 UTSW 5 23525575 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- TTCCTCCTGCTCGGTAAGTG -3'
(R):5'- AAAGGAGAGCCATGACTCTTG -3'

Sequencing Primer
(F):5'- GTAAGTGGCGATCCCTCTGAAATC -3'
(R):5'- GGAGAGCCATGACTCTTGATCTTAC -3'
Posted On2016-06-15