Mutagenetix > Incidental Mutations

Incidental Mutation 'R5044:Cad'

394246

Institutional Source

Beutler Lab

Gene Symbol

Cad

Ensembl Gene

ENSMUSG00000013629

Gene Name

carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase

Synonyms

MMRRC Submission

042634-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R5044 (G1)

Quality Score

132

Status

Validated

Chromosome

Chromosomal Location

31054780-31078479 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 31055021 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 23 (T23A)

Ref Sequence

ENSEMBL: ENSMUSP00000144127 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013766] [ENSMUST00000013773] [ENSMUST00000200942] [ENSMUST00000200953] [ENSMUST00000201136] [ENSMUST00000201174] [ENSMUST00000201182] [ENSMUST00000201773] [ENSMUST00000201838] [ENSMUST00000202795]

AlphaFold

B2RQC6

Predicted Effect

probably benign
Transcript: ENSMUST00000013766

SMART Domains

Protein: ENSMUSP00000013766
Gene: ENSMUSG00000013622

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	149	187	2.03e1	SMART
transmembrane domain	192	214	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000013773
AA Change: T23A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000013773
Gene: ENSMUSG00000013629
AA Change: T23A

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.7e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	1.2e-15	PFAM
Pfam:CPSase_L_D2	514	718	1.8e-85	PFAM
Pfam:ATP-grasp	522	690	1.5e-9	PFAM
Pfam:Dala_Dala_lig_C	527	687	2.2e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	1.8e-23	PFAM
Pfam:CPSase_L_D2	1047	1250	3.1e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	2.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	2.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	7.4e-12	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1924	2065	1.9e-44	PFAM
Pfam:OTCace	2071	2221	7.6e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000031049
AA Change: T23A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000031049
Gene: ENSMUSG00000013629
AA Change: T23A

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	3.8e-48	PFAM
Pfam:CPSase_L_chain	392	509	2.1e-20	PFAM
Pfam:CPSase_L_D2	514	616	1.9e-34	PFAM
Pfam:ATP-grasp	522	626	1.7e-6	PFAM
Pfam:Dala_Dala_lig_C	524	624	2.7e-7	PFAM
Pfam:CPSase_L_D2	614	655	5.2e-15	PFAM
CPSase_L_D3	735	858	9.7e-59	SMART
Pfam:CPSase_L_chain	868	979	2.9e-20	PFAM
Pfam:ATP-grasp_4	981	1160	6.4e-24	PFAM
Pfam:CPSase_L_D2	984	1187	3.5e-28	PFAM
Pfam:Dala_Dala_lig_C	991	1179	1.2e-6	PFAM
Pfam:ATP-grasp	992	1159	1.6e-11	PFAM
MGS	1264	1365	1.35e-7	SMART
Pfam:Amidohydro_5	1374	1437	9.4e-7	PFAM
Pfam:Amidohydro_1	1399	1597	1.9e-12	PFAM
Pfam:Amidohydro_4	1401	1692	5.5e-15	PFAM
low complexity region	1757	1776	N/A	INTRINSIC
low complexity region	1801	1817	N/A	INTRINSIC
Pfam:OTCace_N	1861	2003	1.7e-48	PFAM
Pfam:OTCace	2008	2158	1.5e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000200748

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200800

Predicted Effect

probably benign
Transcript: ENSMUST00000200942

Predicted Effect

probably benign
Transcript: ENSMUST00000200953
AA Change: T23A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000144307
Gene: ENSMUSG00000013629
AA Change: T23A

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.5e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:CPSase_L_D2	514	616	1.5e-34	PFAM
Pfam:Dala_Dala_lig_C	527	625	2.4e-7	PFAM
Pfam:CPSase_L_D2	614	655	4.9e-15	PFAM
CPSase_L_D3	735	858	9.7e-59	SMART
Pfam:ATP-grasp_4	981	1160	1.7e-23	PFAM
Pfam:CPSase_L_D2	984	1187	3e-28	PFAM
Pfam:Dala_Dala_lig_C	991	1179	2.3e-7	PFAM
Pfam:ATP-grasp	992	1159	2.1e-12	PFAM
MGS	1264	1365	1.35e-7	SMART
Pfam:Amidohydro_1	1399	1667	7.1e-12	PFAM
low complexity region	1757	1776	N/A	INTRINSIC
low complexity region	1801	1817	N/A	INTRINSIC
Pfam:OTCace_N	1861	2002	1.8e-44	PFAM
Pfam:OTCace	2008	2158	7.3e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201136

SMART Domains

Protein: ENSMUSP00000144085
Gene: ENSMUSG00000013622

Domain	Start	End	E-Value	Type
EGF	96	134	2.03e1	SMART
transmembrane domain	138	160	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201174

Predicted Effect

probably benign
Transcript: ENSMUST00000201182
AA Change: T23A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000144684
Gene: ENSMUSG00000013629
AA Change: T23A

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	4.5e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	1.1e-15	PFAM
Pfam:CPSase_L_D2	514	718	1.7e-85	PFAM
Pfam:ATP-grasp	522	690	1.4e-9	PFAM
Pfam:Dala_Dala_lig_C	527	687	2.1e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	1.7e-23	PFAM
Pfam:CPSase_L_D2	1047	1250	3e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	2.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	2.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	7.1e-12	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1949	1994	1.4e-11	PFAM
Pfam:OTCace	2000	2150	7.3e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201773

SMART Domains

Protein: ENSMUSP00000144333
Gene: ENSMUSG00000013622

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201838
AA Change: T23A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000144127
Gene: ENSMUSG00000013629
AA Change: T23A

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	6.3e-48	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	1.9e-16	PFAM
Pfam:CPSase_L_D2	514	718	3.7e-86	PFAM
Pfam:ATP-grasp	522	690	2.5e-10	PFAM
Pfam:Dala_Dala_lig_C	526	687	4.2e-11	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
SCOP:d1a9xa3	935	964	1e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201887

Predicted Effect

probably benign
Transcript: ENSMUST00000202795
AA Change: T23A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000144009
Gene: ENSMUSG00000013629
AA Change: T23A

Domain	Start	End	E-Value	Type
CPSase_sm_chain	1	139	8.81e-80	SMART
Pfam:GATase	179	356	1.9e-47	PFAM
low complexity region	397	407	N/A	INTRINSIC
Pfam:ATP-grasp_4	511	692	5.9e-16	PFAM
Pfam:CPSase_L_D2	514	718	1.2e-85	PFAM
Pfam:ATP-grasp	522	690	7.3e-10	PFAM
Pfam:Dala_Dala_lig_C	527	687	1.3e-10	PFAM
CPSase_L_D3	798	921	9.7e-59	SMART
Pfam:ATP-grasp_4	1044	1223	8.9e-24	PFAM
Pfam:CPSase_L_D2	1047	1250	2.1e-28	PFAM
Pfam:Dala_Dala_lig_C	1054	1242	1.3e-7	PFAM
Pfam:ATP-grasp	1055	1222	1.1e-12	PFAM
MGS	1327	1428	1.35e-7	SMART
Pfam:Amidohydro_1	1462	1730	2.5e-11	PFAM
low complexity region	1820	1839	N/A	INTRINSIC
low complexity region	1864	1880	N/A	INTRINSIC
Pfam:OTCace_N	1970	2004	4.6e-11	PFAM
Pfam:OTCace	2010	2160	9.9e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202967

Meta Mutation Damage Score

0.0625

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

96% (73/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The de novo synthesis of pyrimidine nucleotides is required for mammalian cells to proliferate. This gene encodes a trifunctional protein which is associated with the enzymatic activities of the first 3 enzymes in the 6-step pathway of pyrimidine biosynthesis: carbamoylphosphate synthetase (CPS II), aspartate transcarbamoylase, and dihydroorotase. This protein is regulated by the mitogen-activated protein kinase (MAPK) cascade, which indicates a direct link between activation of the MAPK cascade and de novo biosynthesis of pyrimidine nucleotides. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,373,323	F3387I	possibly damaging	Het
Acacb	T	A	5: 114,166,027	S170R	probably benign	Het
Adamtsl4	A	G	3: 95,681,650		probably null	Het
Adgrv1	A	G	13: 81,488,931	C3464R	probably benign	Het
Apbb1	A	T	7: 105,565,682		probably benign	Het
Cdca7	A	G	2: 72,483,415	R183G	probably benign	Het
Cdpf1	T	C	15: 85,809,312	T5A	probably benign	Het
Cep85	T	C	4: 134,156,179	D133G	probably damaging	Het
Chrna9	T	C	5: 65,971,016	L189P	probably damaging	Het
Clca1	A	C	3: 145,007,928		probably null	Het
Cntn1	G	T	15: 92,242,995	V201F	probably damaging	Het
Col4a3	A	G	1: 82,666,546	E352G	unknown	Het
Ddhd2	T	C	8: 25,752,137	Y237C	probably damaging	Het
Dnah6	A	C	6: 73,037,622	F3609V	probably benign	Het
Epha3	T	C	16: 63,602,287	K580R	possibly damaging	Het
Fam135b	T	C	15: 71,462,711	N878S	probably benign	Het
Fam71e2	T	C	7: 4,758,661	N351D	probably benign	Het
Fbn1	T	G	2: 125,329,102	T1938P	probably damaging	Het
Foxg1	T	C	12: 49,385,186	V234A	probably damaging	Het
Glt1d1	A	T	5: 127,644,414	N55I	probably benign	Het
Gm17641	C	A	3: 68,869,474		probably benign	Het
Gm7665	A	G	18: 16,274,731		noncoding transcript	Het
Hgf	A	C	5: 16,614,894	N541T	probably benign	Het
Hipk2	G	A	6: 38,818,879	P152S	probably benign	Het
Jarid2	C	T	13: 44,906,565	L720F	probably damaging	Het
Kifc5b	A	G	17: 26,924,787	E511G	probably damaging	Het
Ldlr	G	A	9: 21,735,242	A235T	probably benign	Het
Lmln	A	G	16: 33,074,180	D231G	possibly damaging	Het
Lrp1	A	G	10: 127,567,495	C2070R	probably damaging	Het
Mbl1	A	G	14: 41,158,724	T190A	possibly damaging	Het
Mpdz	A	T	4: 81,381,697	S355T	probably benign	Het
Muc19	C	T	15: 91,888,138		noncoding transcript	Het
Mycbp2	A	C	14: 103,139,235		probably null	Het
Naa20	T	C	2: 145,915,842	S164P	probably damaging	Het
Nme4	A	T	17: 26,093,833		probably benign	Het
Npas2	A	T	1: 39,347,506	R619*	probably null	Het
Nudt19	G	A	7: 35,555,746	T20I	possibly damaging	Het
Olfr1224-ps1	T	A	2: 89,156,939	K79*	probably null	Het
Olfr1447	A	G	19: 12,901,001	Y260H	probably damaging	Het
Pitpnc1	A	G	11: 107,296,228	Y90H	possibly damaging	Het
Rcor2	A	G	19: 7,269,785	T6A	probably benign	Het
Rif1	T	A	2: 52,109,928	S1131R	probably damaging	Het
Rtkn	T	A	6: 83,150,991	D377E	probably benign	Het
Rtn4rl2	T	A	2: 84,872,502	N242I	probably damaging	Het
Sbno2	G	A	10: 80,062,188	L719F	probably benign	Het
Scn11a	G	T	9: 119,819,831	D55E	probably damaging	Het
Setd1b	T	A	5: 123,151,866	I632N	unknown	Het
Spaca6	A	G	17: 17,831,196	T45A	probably benign	Het
Srpk2	A	T	5: 23,524,392	D416E	possibly damaging	Het
Sspo	A	T	6: 48,466,955		probably null	Het
Sycp1	A	T	3: 102,845,054	I804N	probably benign	Het
Tdp2	G	A	13: 24,831,826	R32Q	probably benign	Het
Tgfbr3	A	G	5: 107,136,929	V618A	possibly damaging	Het
Tmc3	C	T	7: 83,609,118	P439S	probably benign	Het
Tnxb	A	T	17: 34,717,483	D2740V	probably damaging	Het
Tspyl4	A	G	10: 34,297,937	T142A	probably benign	Het
Ttn	T	C	2: 76,880,441		probably benign	Het
Tubgcp4	T	C	2: 121,173,580	L34P	probably damaging	Het
Tubgcp6	G	T	15: 89,099,545		probably benign	Het
Unc79	T	A	12: 103,112,703	V1690E	probably benign	Het
Vps4b	T	C	1: 106,796,418		probably null	Het
Wtap	A	G	17: 12,967,638	S341P	possibly damaging	Het
Wwc1	T	C	11: 35,883,345	T363A	probably benign	Het
Zbtb8a	G	A	4: 129,360,500	T67M	probably damaging	Het
Zfp865	T	C	7: 5,034,669		probably benign	Het

Other mutations in Cad

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Cad	APN	5	31061484	missense	probably damaging	1.00
IGL00908:Cad	APN	5	31059054	missense	possibly damaging	0.93
IGL01068:Cad	APN	5	31061770	splice site	probably benign
IGL01638:Cad	APN	5	31067614	missense	probably damaging	1.00
IGL02483:Cad	APN	5	31060826	critical splice acceptor site	probably null
IGL02499:Cad	APN	5	31069604	missense	probably damaging	1.00
IGL02691:Cad	APN	5	31055294	missense	probably damaging	1.00
IGL03002:Cad	APN	5	31054986	missense	probably benign	0.00
PIT4696001:Cad	UTSW	5	31072094	missense	probably damaging	0.99
R0212:Cad	UTSW	5	31078110	missense	probably damaging	1.00
R0317:Cad	UTSW	5	31072321	missense	probably benign	0.01
R0335:Cad	UTSW	5	31073985	unclassified	probably benign
R0401:Cad	UTSW	5	31073986	unclassified	probably benign
R0445:Cad	UTSW	5	31072709	missense	probably benign	0.08
R0494:Cad	UTSW	5	31077512	unclassified	probably benign
R0532:Cad	UTSW	5	31062187	splice site	probably benign
R0539:Cad	UTSW	5	31075457	splice site	probably benign
R0578:Cad	UTSW	5	31058776	missense	probably benign	0.01
R0590:Cad	UTSW	5	31062231	missense	probably damaging	1.00
R0638:Cad	UTSW	5	31077688	missense	probably damaging	0.98
R0831:Cad	UTSW	5	31067600	missense	probably damaging	1.00
R1329:Cad	UTSW	5	31059582	missense	probably damaging	1.00
R1513:Cad	UTSW	5	31068762	missense	probably damaging	1.00
R1531:Cad	UTSW	5	31076219	missense	probably benign	0.14
R1763:Cad	UTSW	5	31060951	missense	probably damaging	1.00
R1785:Cad	UTSW	5	31058072	missense	probably damaging	1.00
R1786:Cad	UTSW	5	31058072	missense	probably damaging	1.00
R2131:Cad	UTSW	5	31058072	missense	probably damaging	1.00
R2165:Cad	UTSW	5	31062220	missense	probably damaging	1.00
R3103:Cad	UTSW	5	31061674	missense	possibly damaging	0.95
R3113:Cad	UTSW	5	31074137	missense	possibly damaging	0.50
R3762:Cad	UTSW	5	31075546	splice site	probably null
R3847:Cad	UTSW	5	31061650	missense	probably damaging	1.00
R3898:Cad	UTSW	5	31074022	missense	probably benign	0.06
R3943:Cad	UTSW	5	31072385	critical splice donor site	probably null
R4213:Cad	UTSW	5	31072344	missense	probably benign	0.01
R4458:Cad	UTSW	5	31061226	missense	probably damaging	1.00
R4562:Cad	UTSW	5	31058133	missense	possibly damaging	0.82
R4629:Cad	UTSW	5	31070295	missense	probably damaging	1.00
R4717:Cad	UTSW	5	31066686	critical splice acceptor site	probably null
R4811:Cad	UTSW	5	31074690	missense	probably benign	0.02
R5630:Cad	UTSW	5	31060573	missense	probably damaging	1.00
R5660:Cad	UTSW	5	31076847	missense	probably damaging	1.00
R6008:Cad	UTSW	5	31069112	missense	probably damaging	1.00
R6029:Cad	UTSW	5	31054983	missense	possibly damaging	0.65
R6073:Cad	UTSW	5	31062562	missense	possibly damaging	0.84
R6240:Cad	UTSW	5	31072978	missense	probably benign	0.00
R6260:Cad	UTSW	5	31066800	missense	probably null
R7145:Cad	UTSW	5	31067612	missense	possibly damaging	0.89
R7303:Cad	UTSW	5	31060213	critical splice donor site	probably null
R7352:Cad	UTSW	5	31058078	missense	probably damaging	1.00
R7382:Cad	UTSW	5	31075829	missense	probably benign
R7387:Cad	UTSW	5	31061940	missense	probably damaging	1.00
R7455:Cad	UTSW	5	31074162	missense	probably damaging	0.99
R7596:Cad	UTSW	5	31069048	missense	probably benign
R7627:Cad	UTSW	5	31060164	missense	probably damaging	1.00
R7898:Cad	UTSW	5	31061485	missense	probably damaging	1.00
R8022:Cad	UTSW	5	31068806	missense	probably damaging	1.00
R8115:Cad	UTSW	5	31060927	missense	possibly damaging	0.82
R8511:Cad	UTSW	5	31075821	missense	probably benign	0.00
R8523:Cad	UTSW	5	31058106	missense	probably damaging	0.98
R8690:Cad	UTSW	5	31075156	missense	possibly damaging	0.58
R8697:Cad	UTSW	5	31074601	missense	probably benign	0.06
R8698:Cad	UTSW	5	31077475	missense	probably benign
R8699:Cad	UTSW	5	31076261	missense	possibly damaging	0.80
R8803:Cad	UTSW	5	31069564	missense	probably damaging	1.00
R9262:Cad	UTSW	5	31067665	missense	probably null
R9272:Cad	UTSW	5	31061232	missense	possibly damaging	0.91
R9287:Cad	UTSW	5	31072656	missense	possibly damaging	0.67
R9314:Cad	UTSW	5	31077644	missense	probably damaging	1.00
RF001:Cad	UTSW	5	31060212	critical splice donor site	probably benign
RF012:Cad	UTSW	5	31060212	critical splice donor site	probably benign
X0021:Cad	UTSW	5	31068131	missense	probably null	1.00
X0022:Cad	UTSW	5	31072317	missense	probably damaging	0.99
Z1177:Cad	UTSW	5	31068421	missense	probably damaging	1.00
Z1177:Cad	UTSW	5	31075128	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- TCACTACGCTTAGGGCTCTG -3'
(R):5'- ATGCCGGTCTGAAACACTGAAG -3'

Sequencing Primer
(F):5'- CTACGCTTAGGGCTCTGGCTTG -3'
(R):5'- CTGAGTTCAGGCAAGGGCAC -3'

Posted On

2016-06-15