Incidental Mutation 'R5044:Setd1b'
ID 394250
Institutional Source Beutler Lab
Gene Symbol Setd1b
Ensembl Gene ENSMUSG00000038384
Gene Name SET domain containing 1B
Synonyms KMT2G
MMRRC Submission 042634-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5044 (G1)
Quality Score 132
Status Not validated
Chromosome 5
Chromosomal Location 123142193-123168629 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 123151866 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 632 (I632N)
Ref Sequence ENSEMBL: ENSMUSP00000134461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056053] [ENSMUST00000163030] [ENSMUST00000174836]
AlphaFold Q8CFT2
Predicted Effect unknown
Transcript: ENSMUST00000056053
AA Change: I632N
SMART Domains Protein: ENSMUSP00000134686
Gene: ENSMUSG00000038384
AA Change: I632N

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
RRM 103 176 6.41e-13 SMART
low complexity region 229 241 N/A INTRINSIC
internal_repeat_1 248 266 1.29e-7 PROSPERO
internal_repeat_1 279 296 1.29e-7 PROSPERO
low complexity region 366 381 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 422 448 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 565 599 N/A INTRINSIC
low complexity region 650 746 N/A INTRINSIC
Blast:SET 749 976 5e-26 BLAST
low complexity region 979 992 N/A INTRINSIC
coiled coil region 1053 1088 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
coiled coil region 1190 1213 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1281 1292 N/A INTRINSIC
low complexity region 1322 1383 N/A INTRINSIC
low complexity region 1402 1442 N/A INTRINSIC
low complexity region 1484 1548 N/A INTRINSIC
low complexity region 1600 1618 N/A INTRINSIC
N-SET 1692 1836 1.54e-67 SMART
SET 1846 1969 4.03e-36 SMART
PostSET 1969 1985 4.8e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100731
Predicted Effect unknown
Transcript: ENSMUST00000163030
AA Change: I632N
SMART Domains Protein: ENSMUSP00000133933
Gene: ENSMUSG00000038384
AA Change: I632N

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
RRM 103 176 6.41e-13 SMART
low complexity region 229 241 N/A INTRINSIC
internal_repeat_1 248 266 1.29e-7 PROSPERO
internal_repeat_1 279 296 1.29e-7 PROSPERO
low complexity region 366 381 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 422 448 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 565 599 N/A INTRINSIC
low complexity region 650 746 N/A INTRINSIC
Blast:SET 749 976 5e-26 BLAST
low complexity region 979 992 N/A INTRINSIC
coiled coil region 1053 1088 N/A INTRINSIC
low complexity region 1136 1147 N/A INTRINSIC
coiled coil region 1190 1213 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1281 1292 N/A INTRINSIC
low complexity region 1322 1383 N/A INTRINSIC
low complexity region 1402 1442 N/A INTRINSIC
low complexity region 1484 1548 N/A INTRINSIC
low complexity region 1600 1618 N/A INTRINSIC
N-SET 1692 1836 1.54e-67 SMART
SET 1846 1969 4.03e-36 SMART
PostSET 1969 1985 4.8e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174836
AA Change: I632N
SMART Domains Protein: ENSMUSP00000134461
Gene: ENSMUSG00000038384
AA Change: I632N

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
RRM 103 176 6.41e-13 SMART
low complexity region 229 241 N/A INTRINSIC
internal_repeat_1 248 266 1.92e-7 PROSPERO
internal_repeat_1 279 296 1.92e-7 PROSPERO
low complexity region 366 381 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 422 448 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 565 599 N/A INTRINSIC
low complexity region 650 746 N/A INTRINSIC
Blast:SET 749 976 5e-26 BLAST
low complexity region 979 992 N/A INTRINSIC
coiled coil region 1053 1088 N/A INTRINSIC
coiled coil region 1149 1172 N/A INTRINSIC
low complexity region 1208 1221 N/A INTRINSIC
low complexity region 1240 1251 N/A INTRINSIC
low complexity region 1281 1342 N/A INTRINSIC
low complexity region 1361 1401 N/A INTRINSIC
low complexity region 1443 1507 N/A INTRINSIC
low complexity region 1559 1577 N/A INTRINSIC
N-SET 1651 1795 1.54e-67 SMART
SET 1805 1928 4.03e-36 SMART
PostSET 1928 1944 4.8e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181022
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (73/76)
MGI Phenotype PHENOTYPE: Homozygous mutant animals died during organogenesis by E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,323 F3387I possibly damaging Het
Acacb T A 5: 114,166,027 S170R probably benign Het
Adamtsl4 A G 3: 95,681,650 probably null Het
Adgrv1 A G 13: 81,488,931 C3464R probably benign Het
Apbb1 A T 7: 105,565,682 probably benign Het
Cad A G 5: 31,055,021 T23A probably benign Het
Cdca7 A G 2: 72,483,415 R183G probably benign Het
Cdpf1 T C 15: 85,809,312 T5A probably benign Het
Cep85 T C 4: 134,156,179 D133G probably damaging Het
Chrna9 T C 5: 65,971,016 L189P probably damaging Het
Clca1 A C 3: 145,007,928 probably null Het
Cntn1 G T 15: 92,242,995 V201F probably damaging Het
Col4a3 A G 1: 82,666,546 E352G unknown Het
Ddhd2 T C 8: 25,752,137 Y237C probably damaging Het
Dnah6 A C 6: 73,037,622 F3609V probably benign Het
Epha3 T C 16: 63,602,287 K580R possibly damaging Het
Fam135b T C 15: 71,462,711 N878S probably benign Het
Fam71e2 T C 7: 4,758,661 N351D probably benign Het
Fbn1 T G 2: 125,329,102 T1938P probably damaging Het
Foxg1 T C 12: 49,385,186 V234A probably damaging Het
Glt1d1 A T 5: 127,644,414 N55I probably benign Het
Gm17641 C A 3: 68,869,474 probably benign Het
Gm7665 A G 18: 16,274,731 noncoding transcript Het
Hgf A C 5: 16,614,894 N541T probably benign Het
Hipk2 G A 6: 38,818,879 P152S probably benign Het
Jarid2 C T 13: 44,906,565 L720F probably damaging Het
Kifc5b A G 17: 26,924,787 E511G probably damaging Het
Ldlr G A 9: 21,735,242 A235T probably benign Het
Lmln A G 16: 33,074,180 D231G possibly damaging Het
Lrp1 A G 10: 127,567,495 C2070R probably damaging Het
Mbl1 A G 14: 41,158,724 T190A possibly damaging Het
Mpdz A T 4: 81,381,697 S355T probably benign Het
Muc19 C T 15: 91,888,138 noncoding transcript Het
Mycbp2 A C 14: 103,139,235 probably null Het
Naa20 T C 2: 145,915,842 S164P probably damaging Het
Nme4 A T 17: 26,093,833 probably benign Het
Npas2 A T 1: 39,347,506 R619* probably null Het
Nudt19 G A 7: 35,555,746 T20I possibly damaging Het
Olfr1224-ps1 T A 2: 89,156,939 K79* probably null Het
Olfr1447 A G 19: 12,901,001 Y260H probably damaging Het
Pitpnc1 A G 11: 107,296,228 Y90H possibly damaging Het
Rcor2 A G 19: 7,269,785 T6A probably benign Het
Rif1 T A 2: 52,109,928 S1131R probably damaging Het
Rtkn T A 6: 83,150,991 D377E probably benign Het
Rtn4rl2 T A 2: 84,872,502 N242I probably damaging Het
Sbno2 G A 10: 80,062,188 L719F probably benign Het
Scn11a G T 9: 119,819,831 D55E probably damaging Het
Spaca6 A G 17: 17,831,196 T45A probably benign Het
Srpk2 A T 5: 23,524,392 D416E possibly damaging Het
Sspo A T 6: 48,466,955 probably null Het
Sycp1 A T 3: 102,845,054 I804N probably benign Het
Tdp2 G A 13: 24,831,826 R32Q probably benign Het
Tgfbr3 A G 5: 107,136,929 V618A possibly damaging Het
Tmc3 C T 7: 83,609,118 P439S probably benign Het
Tnxb A T 17: 34,717,483 D2740V probably damaging Het
Tspyl4 A G 10: 34,297,937 T142A probably benign Het
Ttn T C 2: 76,880,441 probably benign Het
Tubgcp4 T C 2: 121,173,580 L34P probably damaging Het
Tubgcp6 G T 15: 89,099,545 probably benign Het
Unc79 T A 12: 103,112,703 V1690E probably benign Het
Vps4b T C 1: 106,796,418 probably null Het
Wtap A G 17: 12,967,638 S341P possibly damaging Het
Wwc1 T C 11: 35,883,345 T363A probably benign Het
Zbtb8a G A 4: 129,360,500 T67M probably damaging Het
Zfp865 T C 7: 5,034,669 probably benign Het
Other mutations in Setd1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Setd1b APN 5 123158747 unclassified probably benign
IGL01453:Setd1b APN 5 123158464 intron probably benign
IGL01637:Setd1b APN 5 123148513 missense unknown
IGL01792:Setd1b APN 5 123157146 missense unknown
IGL01877:Setd1b APN 5 123148448 missense unknown
IGL01906:Setd1b APN 5 123157667 missense unknown
IGL01942:Setd1b APN 5 123163426 missense possibly damaging 0.73
IGL02284:Setd1b APN 5 123163428 missense possibly damaging 0.52
IGL02667:Setd1b APN 5 123157497 missense unknown
IGL02850:Setd1b APN 5 123148589 missense unknown
IGL02864:Setd1b APN 5 123158939 unclassified probably benign
IGL03006:Setd1b APN 5 123148451 missense unknown
IGL03307:Setd1b APN 5 123148671 missense unknown
P0037:Setd1b UTSW 5 123165921 unclassified probably benign
R0282:Setd1b UTSW 5 123161017 unclassified probably benign
R0375:Setd1b UTSW 5 123157437 missense unknown
R0550:Setd1b UTSW 5 123157660 missense unknown
R0607:Setd1b UTSW 5 123159951 unclassified probably benign
R0844:Setd1b UTSW 5 123160685 unclassified probably benign
R0973:Setd1b UTSW 5 123160703 small insertion probably benign
R1119:Setd1b UTSW 5 123147716 missense unknown
R1266:Setd1b UTSW 5 123147841 missense unknown
R1370:Setd1b UTSW 5 123160685 unclassified probably benign
R1416:Setd1b UTSW 5 123160685 unclassified probably benign
R1575:Setd1b UTSW 5 123163147 splice site probably benign
R1862:Setd1b UTSW 5 123147613 missense unknown
R1987:Setd1b UTSW 5 123147706 missense unknown
R4109:Setd1b UTSW 5 123152074 small deletion probably benign
R4399:Setd1b UTSW 5 123161798 unclassified probably benign
R4445:Setd1b UTSW 5 123148104 missense unknown
R4577:Setd1b UTSW 5 123148616 missense unknown
R4604:Setd1b UTSW 5 123152074 small deletion probably benign
R4647:Setd1b UTSW 5 123148112 missense unknown
R4648:Setd1b UTSW 5 123148112 missense unknown
R4675:Setd1b UTSW 5 123160998 unclassified probably benign
R5071:Setd1b UTSW 5 123160914 unclassified probably benign
R5220:Setd1b UTSW 5 123143408 missense unknown
R5933:Setd1b UTSW 5 123158752 unclassified probably benign
R6247:Setd1b UTSW 5 123158398 intron probably benign
R6446:Setd1b UTSW 5 123161799 unclassified probably benign
R6714:Setd1b UTSW 5 123157591 missense unknown
R6907:Setd1b UTSW 5 123163232 unclassified probably benign
R7328:Setd1b UTSW 5 123152379 missense unknown
R7412:Setd1b UTSW 5 123152576 missense unknown
R7486:Setd1b UTSW 5 123163592 missense probably benign 0.03
R7542:Setd1b UTSW 5 123148447 missense unknown
R7555:Setd1b UTSW 5 123157757 missense unknown
R7611:Setd1b UTSW 5 123152594 missense unknown
R7764:Setd1b UTSW 5 123146559 missense unknown
R7770:Setd1b UTSW 5 123158752 unclassified probably benign
R7881:Setd1b UTSW 5 123152273 missense unknown
R7977:Setd1b UTSW 5 123147680 missense unknown
R7987:Setd1b UTSW 5 123147680 missense unknown
R8131:Setd1b UTSW 5 123143380 missense unknown
R8386:Setd1b UTSW 5 123144256 missense unknown
R8845:Setd1b UTSW 5 123144247 missense unknown
R8901:Setd1b UTSW 5 123161051 unclassified probably benign
R9224:Setd1b UTSW 5 123158710 missense unknown
R9438:Setd1b UTSW 5 123147881 missense unknown
Z1177:Setd1b UTSW 5 123158625 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGGTTGACTGATGTGCCC -3'
(R):5'- CATGTCCACCTGCATCACAG -3'

Sequencing Primer
(F):5'- TGACTGATGTGCCCGAGGTC -3'
(R):5'- ACTGTCACTGCAGGATGGG -3'
Posted On 2016-06-15