Incidental Mutation 'R5044:Hipk2'
ID 394252
Institutional Source Beutler Lab
Gene Symbol Hipk2
Ensembl Gene ENSMUSG00000061436
Gene Name homeodomain interacting protein kinase 2
Synonyms 1110014O20Rik, Stank, B230339E18Rik
MMRRC Submission 042634-MU
Accession Numbers

Ncbi RefSeq: NM_001136065.1, NM_010433.2; MGI: 1314872

Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock # R5044 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 38694390-38876165 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 38818879 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 152 (P152S)
Ref Sequence ENSEMBL: ENSMUSP00000125150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160360] [ENSMUST00000160962] [ENSMUST00000161779] [ENSMUST00000162359]
AlphaFold Q9QZR5
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159894
Predicted Effect probably benign
Transcript: ENSMUST00000160360
AA Change: P152S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000125500
Gene: ENSMUSG00000061436
AA Change: P152S

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 895 909 N/A INTRINSIC
low complexity region 963 992 N/A INTRINSIC
low complexity region 998 1018 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160962
AA Change: P145S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000125572
Gene: ENSMUSG00000061436
AA Change: P145S

DomainStartEndE-ValueType
low complexity region 87 97 N/A INTRINSIC
low complexity region 149 173 N/A INTRINSIC
S_TKc 192 520 3.05e-78 SMART
low complexity region 888 902 N/A INTRINSIC
low complexity region 956 985 N/A INTRINSIC
low complexity region 991 1011 N/A INTRINSIC
low complexity region 1050 1065 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161779
AA Change: P152S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124133
Gene: ENSMUSG00000061436
AA Change: P152S

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 923 937 N/A INTRINSIC
low complexity region 991 1020 N/A INTRINSIC
low complexity region 1026 1046 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162359
AA Change: P152S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125150
Gene: ENSMUSG00000061436
AA Change: P152S

DomainStartEndE-ValueType
low complexity region 94 104 N/A INTRINSIC
low complexity region 156 180 N/A INTRINSIC
S_TKc 199 527 3.05e-78 SMART
low complexity region 896 910 N/A INTRINSIC
low complexity region 964 993 N/A INTRINSIC
low complexity region 999 1019 N/A INTRINSIC
low complexity region 1058 1073 N/A INTRINSIC
Meta Mutation Damage Score 0.0685 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (73/76)
MGI Phenotype Strain: 3624127; 3487301; 4429497
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved serine/threonine kinase that is a member of the homeodomain-interacting protein kinase family. The encoded protein interacts with homeodomain transcription factors and many other transcription factors such as p53, and can function as both a corepressor and a coactivator depending on the transcription factor and its subcellular localization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display decreased apoptosis and increased neuron numbers in the trigeminal ganglion. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(3)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,323 F3387I possibly damaging Het
Acacb T A 5: 114,166,027 S170R probably benign Het
Adamtsl4 A G 3: 95,681,650 probably null Het
Adgrv1 A G 13: 81,488,931 C3464R probably benign Het
Apbb1 A T 7: 105,565,682 probably benign Het
Cad A G 5: 31,055,021 T23A probably benign Het
Cdca7 A G 2: 72,483,415 R183G probably benign Het
Cdpf1 T C 15: 85,809,312 T5A probably benign Het
Cep85 T C 4: 134,156,179 D133G probably damaging Het
Chrna9 T C 5: 65,971,016 L189P probably damaging Het
Clca1 A C 3: 145,007,928 probably null Het
Cntn1 G T 15: 92,242,995 V201F probably damaging Het
Col4a3 A G 1: 82,666,546 E352G unknown Het
Ddhd2 T C 8: 25,752,137 Y237C probably damaging Het
Dnah6 A C 6: 73,037,622 F3609V probably benign Het
Epha3 T C 16: 63,602,287 K580R possibly damaging Het
Fam135b T C 15: 71,462,711 N878S probably benign Het
Fam71e2 T C 7: 4,758,661 N351D probably benign Het
Fbn1 T G 2: 125,329,102 T1938P probably damaging Het
Foxg1 T C 12: 49,385,186 V234A probably damaging Het
Glt1d1 A T 5: 127,644,414 N55I probably benign Het
Gm17641 C A 3: 68,869,474 probably benign Het
Gm7665 A G 18: 16,274,731 noncoding transcript Het
Hgf A C 5: 16,614,894 N541T probably benign Het
Jarid2 C T 13: 44,906,565 L720F probably damaging Het
Kifc5b A G 17: 26,924,787 E511G probably damaging Het
Ldlr G A 9: 21,735,242 A235T probably benign Het
Lmln A G 16: 33,074,180 D231G possibly damaging Het
Lrp1 A G 10: 127,567,495 C2070R probably damaging Het
Mbl1 A G 14: 41,158,724 T190A possibly damaging Het
Mpdz A T 4: 81,381,697 S355T probably benign Het
Muc19 C T 15: 91,888,138 noncoding transcript Het
Mycbp2 A C 14: 103,139,235 probably null Het
Naa20 T C 2: 145,915,842 S164P probably damaging Het
Nme4 A T 17: 26,093,833 probably benign Het
Npas2 A T 1: 39,347,506 R619* probably null Het
Nudt19 G A 7: 35,555,746 T20I possibly damaging Het
Olfr1224-ps1 T A 2: 89,156,939 K79* probably null Het
Olfr1447 A G 19: 12,901,001 Y260H probably damaging Het
Pitpnc1 A G 11: 107,296,228 Y90H possibly damaging Het
Rcor2 A G 19: 7,269,785 T6A probably benign Het
Rif1 T A 2: 52,109,928 S1131R probably damaging Het
Rtkn T A 6: 83,150,991 D377E probably benign Het
Rtn4rl2 T A 2: 84,872,502 N242I probably damaging Het
Sbno2 G A 10: 80,062,188 L719F probably benign Het
Scn11a G T 9: 119,819,831 D55E probably damaging Het
Setd1b T A 5: 123,151,866 I632N unknown Het
Spaca6 A G 17: 17,831,196 T45A probably benign Het
Srpk2 A T 5: 23,524,392 D416E possibly damaging Het
Sspo A T 6: 48,466,955 probably null Het
Sycp1 A T 3: 102,845,054 I804N probably benign Het
Tdp2 G A 13: 24,831,826 R32Q probably benign Het
Tgfbr3 A G 5: 107,136,929 V618A possibly damaging Het
Tmc3 C T 7: 83,609,118 P439S probably benign Het
Tnxb A T 17: 34,717,483 D2740V probably damaging Het
Tspyl4 A G 10: 34,297,937 T142A probably benign Het
Ttn T C 2: 76,880,441 probably benign Het
Tubgcp4 T C 2: 121,173,580 L34P probably damaging Het
Tubgcp6 G T 15: 89,099,545 probably benign Het
Unc79 T A 12: 103,112,703 V1690E probably benign Het
Vps4b T C 1: 106,796,418 probably null Het
Wtap A G 17: 12,967,638 S341P possibly damaging Het
Wwc1 T C 11: 35,883,345 T363A probably benign Het
Zbtb8a G A 4: 129,360,500 T67M probably damaging Het
Zfp865 T C 7: 5,034,669 probably benign Het
Other mutations in Hipk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Hipk2 APN 6 38819322 splice site probably benign
IGL00814:Hipk2 APN 6 38818549 missense probably damaging 1.00
IGL00907:Hipk2 APN 6 38818273 missense probably damaging 1.00
IGL01350:Hipk2 APN 6 38818315 missense probably damaging 1.00
IGL01714:Hipk2 APN 6 38819182 missense probably damaging 1.00
IGL01893:Hipk2 APN 6 38818395 missense probably benign 0.05
IGL02028:Hipk2 APN 6 38818756 missense possibly damaging 0.67
IGL02133:Hipk2 APN 6 38819134 missense probably benign
IGL02135:Hipk2 APN 6 38818999 missense possibly damaging 0.90
IGL02543:Hipk2 APN 6 38703501 missense possibly damaging 0.95
IGL02630:Hipk2 APN 6 38818521 missense possibly damaging 0.48
IGL02896:Hipk2 APN 6 38698447 missense probably damaging 1.00
IGL02900:Hipk2 APN 6 38729944 missense probably damaging 0.96
IGL03345:Hipk2 APN 6 38748002 splice site probably benign
R0070:Hipk2 UTSW 6 38818984 nonsense probably null
R0070:Hipk2 UTSW 6 38818984 nonsense probably null
R0092:Hipk2 UTSW 6 38743229 missense probably damaging 0.97
R0184:Hipk2 UTSW 6 38718931 missense possibly damaging 0.77
R0494:Hipk2 UTSW 6 38729989 missense probably benign 0.03
R0617:Hipk2 UTSW 6 38747485 missense possibly damaging 0.70
R0720:Hipk2 UTSW 6 38698556 missense probably damaging 1.00
R1812:Hipk2 UTSW 6 38698163 missense probably benign 0.14
R1864:Hipk2 UTSW 6 38718935 critical splice acceptor site probably null
R1919:Hipk2 UTSW 6 38818984 nonsense probably null
R1995:Hipk2 UTSW 6 38715974 missense probably damaging 1.00
R2079:Hipk2 UTSW 6 38818785 missense probably damaging 1.00
R2238:Hipk2 UTSW 6 38729915 splice site probably benign
R2384:Hipk2 UTSW 6 38818371 missense probably damaging 0.99
R3775:Hipk2 UTSW 6 38743094 missense probably damaging 0.99
R3792:Hipk2 UTSW 6 38698556 missense probably damaging 1.00
R3841:Hipk2 UTSW 6 38818926 missense probably damaging 1.00
R3883:Hipk2 UTSW 6 38699265 missense probably damaging 1.00
R4471:Hipk2 UTSW 6 38736922 intron probably benign
R4724:Hipk2 UTSW 6 38698392 missense probably benign 0.10
R4838:Hipk2 UTSW 6 38818404 missense possibly damaging 0.94
R4843:Hipk2 UTSW 6 38819257 missense possibly damaging 0.94
R5040:Hipk2 UTSW 6 38730881 missense possibly damaging 0.82
R5320:Hipk2 UTSW 6 38818277 missense probably damaging 1.00
R5409:Hipk2 UTSW 6 38730042 missense probably damaging 1.00
R5682:Hipk2 UTSW 6 38737473 missense possibly damaging 0.50
R5695:Hipk2 UTSW 6 38818875 missense possibly damaging 0.64
R5876:Hipk2 UTSW 6 38730867 critical splice donor site probably null
R6309:Hipk2 UTSW 6 38698511 missense probably damaging 1.00
R6612:Hipk2 UTSW 6 38818873 missense probably benign 0.04
R6815:Hipk2 UTSW 6 38818842 missense probably damaging 1.00
R7104:Hipk2 UTSW 6 38818644 missense probably damaging 0.98
R7124:Hipk2 UTSW 6 38818478 nonsense probably null
R7238:Hipk2 UTSW 6 38716057 missense probably benign 0.45
R7712:Hipk2 UTSW 6 38703634 missense probably benign 0.02
R7994:Hipk2 UTSW 6 38818468 missense possibly damaging 0.94
R8190:Hipk2 UTSW 6 38818793 missense possibly damaging 0.88
R8388:Hipk2 UTSW 6 38745695 missense probably damaging 1.00
R8796:Hipk2 UTSW 6 38698223 missense probably damaging 0.99
R9041:Hipk2 UTSW 6 38747974 nonsense probably null
R9388:Hipk2 UTSW 6 38731021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGCCCAAATGTCCCTCG -3'
(R):5'- ACGAGCAGACCATCATCTTC -3'

Sequencing Primer
(F):5'- ATGTCCCTCGCCCCAAG -3'
(R):5'- CTGGACACATAGTTGTAACATCAGC -3'
Posted On 2016-06-15