Incidental Mutation 'R5044:Rtkn'
ID394255
Institutional Source Beutler Lab
Gene Symbol Rtkn
Ensembl Gene ENSMUSG00000034930
Gene Namerhotekin
Synonyms
MMRRC Submission 042634-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R5044 (G1)
Quality Score157
Status Validated
Chromosome6
Chromosomal Location83135463-83152579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83150991 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 377 (D377E)
Ref Sequence ENSEMBL: ENSMUSP00000112501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065512] [ENSMUST00000087938] [ENSMUST00000121093] [ENSMUST00000125894] [ENSMUST00000129316] [ENSMUST00000130622] [ENSMUST00000135490] [ENSMUST00000153148]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032108
Predicted Effect probably benign
Transcript: ENSMUST00000065512
AA Change: D390E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000065571
Gene: ENSMUSG00000034930
AA Change: D390E

DomainStartEndE-ValueType
Hr1 36 99 5.65e-13 SMART
Pfam:Anillin 117 270 8.3e-46 PFAM
PH 310 418 2.3e-4 SMART
low complexity region 490 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087938
AA Change: D377E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000085249
Gene: ENSMUSG00000034930
AA Change: D377E

DomainStartEndE-ValueType
Hr1 23 86 1.62e-13 SMART
Pfam:Anillin 103 258 8e-25 PFAM
PH 297 405 2.3e-4 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121093
AA Change: D377E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000112501
Gene: ENSMUSG00000034930
AA Change: D377E

DomainStartEndE-ValueType
Hr1 23 86 1.62e-13 SMART
Pfam:Anillin 103 258 8e-25 PFAM
PH 297 405 2.3e-4 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125894
SMART Domains Protein: ENSMUSP00000122873
Gene: ENSMUSG00000030032

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129316
SMART Domains Protein: ENSMUSP00000120640
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Blast:Hr1 1 49 6e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130622
SMART Domains Protein: ENSMUSP00000122660
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Hr1 55 118 1.97e-12 SMART
Pfam:Anillin 135 217 2.8e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133226
Predicted Effect probably benign
Transcript: ENSMUST00000135490
SMART Domains Protein: ENSMUSP00000116964
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Blast:Hr1 1 49 2e-25 BLAST
Pfam:Anillin 66 221 1.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146969
Predicted Effect probably benign
Transcript: ENSMUST00000153148
SMART Domains Protein: ENSMUSP00000116608
Gene: ENSMUSG00000030032

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
WD40 153 197 5.92e1 SMART
WD40 201 238 3.55e1 SMART
WD40 241 280 1.79e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203183
Predicted Effect probably benign
Transcript: ENSMUST00000213056
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that interacts with GTP-bound Rho proteins. Binding of this protein inhibits the GTPase activity of Rho proteins. This protein may interfere with the conversion of active, GTP-bound Rho to the inactive GDP-bound form by RhoGAP. Rho proteins regulate many important cellular processes, including cytokinesis, transcription, smooth muscle contraction, cell growth and transformation. Dysregulation of the Rho signal transduction pathway has been implicated in many forms of cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,323 F3387I possibly damaging Het
Acacb T A 5: 114,166,027 S170R probably benign Het
Adamtsl4 A G 3: 95,681,650 probably null Het
Adgrv1 A G 13: 81,488,931 C3464R probably benign Het
Apbb1 A T 7: 105,565,682 probably benign Het
Cad A G 5: 31,055,021 T23A probably benign Het
Cdca7 A G 2: 72,483,415 R183G probably benign Het
Cdpf1 T C 15: 85,809,312 T5A probably benign Het
Cep85 T C 4: 134,156,179 D133G probably damaging Het
Chrna9 T C 5: 65,971,016 L189P probably damaging Het
Clca1 A C 3: 145,007,928 probably null Het
Cntn1 G T 15: 92,242,995 V201F probably damaging Het
Col4a3 A G 1: 82,666,546 E352G unknown Het
Ddhd2 T C 8: 25,752,137 Y237C probably damaging Het
Dnah6 A C 6: 73,037,622 F3609V probably benign Het
Epha3 T C 16: 63,602,287 K580R possibly damaging Het
Fam135b T C 15: 71,462,711 N878S probably benign Het
Fam71e2 T C 7: 4,758,661 N351D probably benign Het
Fbn1 T G 2: 125,329,102 T1938P probably damaging Het
Foxg1 T C 12: 49,385,186 V234A probably damaging Het
Glt1d1 A T 5: 127,644,414 N55I probably benign Het
Gm17641 C A 3: 68,869,474 probably benign Het
Gm7665 A G 18: 16,274,731 noncoding transcript Het
Hgf A C 5: 16,614,894 N541T probably benign Het
Hipk2 G A 6: 38,818,879 P152S probably benign Het
Jarid2 C T 13: 44,906,565 L720F probably damaging Het
Kifc5b A G 17: 26,924,787 E511G probably damaging Het
Ldlr G A 9: 21,735,242 A235T probably benign Het
Lmln A G 16: 33,074,180 D231G possibly damaging Het
Lrp1 A G 10: 127,567,495 C2070R probably damaging Het
Mbl1 A G 14: 41,158,724 T190A possibly damaging Het
Mpdz A T 4: 81,381,697 S355T probably benign Het
Muc19 C T 15: 91,888,138 noncoding transcript Het
Mycbp2 A C 14: 103,139,235 probably null Het
Naa20 T C 2: 145,915,842 S164P probably damaging Het
Nme4 A T 17: 26,093,833 probably benign Het
Npas2 A T 1: 39,347,506 R619* probably null Het
Nudt19 G A 7: 35,555,746 T20I possibly damaging Het
Olfr1224-ps1 T A 2: 89,156,939 K79* probably null Het
Olfr1447 A G 19: 12,901,001 Y260H probably damaging Het
Pitpnc1 A G 11: 107,296,228 Y90H possibly damaging Het
Rcor2 A G 19: 7,269,785 T6A probably benign Het
Rif1 T A 2: 52,109,928 S1131R probably damaging Het
Rtn4rl2 T A 2: 84,872,502 N242I probably damaging Het
Sbno2 G A 10: 80,062,188 L719F probably benign Het
Scn11a G T 9: 119,819,831 D55E probably damaging Het
Setd1b T A 5: 123,151,866 I632N unknown Het
Spaca6 A G 17: 17,831,196 T45A probably benign Het
Srpk2 A T 5: 23,524,392 D416E possibly damaging Het
Sspo A T 6: 48,466,955 probably null Het
Sycp1 A T 3: 102,845,054 I804N probably benign Het
Tdp2 G A 13: 24,831,826 R32Q probably benign Het
Tgfbr3 A G 5: 107,136,929 V618A possibly damaging Het
Tmc3 C T 7: 83,609,118 P439S probably benign Het
Tnxb A T 17: 34,717,483 D2740V probably damaging Het
Tspyl4 A G 10: 34,297,937 T142A probably benign Het
Ttn T C 2: 76,880,441 probably benign Het
Tubgcp4 T C 2: 121,173,580 L34P probably damaging Het
Tubgcp6 G T 15: 89,099,545 probably benign Het
Unc79 T A 12: 103,112,703 V1690E probably benign Het
Vps4b T C 1: 106,796,418 probably null Het
Wtap A G 17: 12,967,638 S341P possibly damaging Het
Wwc1 T C 11: 35,883,345 T363A probably benign Het
Zbtb8a G A 4: 129,360,500 T67M probably damaging Het
Zfp865 T C 7: 5,034,669 probably benign Het
Other mutations in Rtkn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Rtkn APN 6 83146061 missense probably damaging 1.00
IGL02265:Rtkn APN 6 83147542 missense probably damaging 1.00
IGL02551:Rtkn APN 6 83151924 missense probably damaging 1.00
IGL03028:Rtkn APN 6 83147872 nonsense probably null
IGL03388:Rtkn APN 6 83150090 missense probably benign 0.02
R1648:Rtkn UTSW 6 83135994 missense probably damaging 1.00
R2100:Rtkn UTSW 6 83149560 unclassified probably null
R2517:Rtkn UTSW 6 83147545 missense probably damaging 1.00
R3608:Rtkn UTSW 6 83150035 missense probably damaging 0.97
R3946:Rtkn UTSW 6 83135976 missense probably benign 0.01
R4170:Rtkn UTSW 6 83142395 start codon destroyed probably null
R4630:Rtkn UTSW 6 83152182 nonsense probably null
R5102:Rtkn UTSW 6 83149773 missense probably damaging 0.98
R6165:Rtkn UTSW 6 83145963 missense probably damaging 1.00
R6372:Rtkn UTSW 6 83151901 missense possibly damaging 0.96
R7101:Rtkn UTSW 6 83150012 missense possibly damaging 0.76
R7155:Rtkn UTSW 6 83149711 missense probably damaging 0.99
R7251:Rtkn UTSW 6 83135962 missense probably damaging 1.00
R7381:Rtkn UTSW 6 83151745 missense probably damaging 0.97
R7598:Rtkn UTSW 6 83147903 missense probably null 0.96
R7624:Rtkn UTSW 6 83152177 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCGGAAGTCCCAAAGGTAC -3'
(R):5'- GATCTTCATGACTTCATCACAACAGTG -3'

Sequencing Primer
(F):5'- AGGTACTGCTAGGCCAGTCTAG -3'
(R):5'- GAGGACCAGACCCATGCAG -3'
Posted On2016-06-15