Mutagenetix > Incidental Mutations

Incidental Mutation 'R5044:Rtkn'

394255

Institutional Source

Beutler Lab

Gene Symbol

Rtkn

Ensembl Gene

ENSMUSG00000034930

Gene Name

rhotekin

Synonyms

MMRRC Submission

042634-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.213) question?

Stock #

R5044 (G1)

Quality Score

157

Status

Validated

Chromosome

Chromosomal Location

83135463-83152579 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83150991 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 377 (D377E)

Ref Sequence

ENSEMBL: ENSMUSP00000112501 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065512] [ENSMUST00000087938] [ENSMUST00000121093] [ENSMUST00000125894] [ENSMUST00000129316] [ENSMUST00000130622] [ENSMUST00000135490] [ENSMUST00000153148]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000032108

Predicted Effect

probably benign
Transcript: ENSMUST00000065512
AA Change: D390E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000065571
Gene: ENSMUSG00000034930
AA Change: D390E

Domain	Start	End	E-Value	Type
Hr1	36	99	5.65e-13	SMART
Pfam:Anillin	117	270	8.3e-46	PFAM
PH	310	418	2.3e-4	SMART
low complexity region	490	505	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000087938
AA Change: D377E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000085249
Gene: ENSMUSG00000034930
AA Change: D377E

Domain	Start	End	E-Value	Type
Hr1	23	86	1.62e-13	SMART
Pfam:Anillin	103	258	8e-25	PFAM
PH	297	405	2.3e-4	SMART
low complexity region	477	492	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121093
AA Change: D377E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000112501
Gene: ENSMUSG00000034930
AA Change: D377E

Domain	Start	End	E-Value	Type
Hr1	23	86	1.62e-13	SMART
Pfam:Anillin	103	258	8e-25	PFAM
PH	297	405	2.3e-4	SMART
low complexity region	477	492	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125894

SMART Domains

Protein: ENSMUSP00000122873
Gene: ENSMUSG00000030032

Domain	Start	End	E-Value	Type
low complexity region	12	22	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129316

SMART Domains

Protein: ENSMUSP00000120640
Gene: ENSMUSG00000034930

Domain	Start	End	E-Value	Type
Blast:Hr1	1	49	6e-27	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000130622

SMART Domains

Protein: ENSMUSP00000122660
Gene: ENSMUSG00000034930

Domain	Start	End	E-Value	Type
Hr1	55	118	1.97e-12	SMART
Pfam:Anillin	135	217	2.8e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133226

Predicted Effect

probably benign
Transcript: ENSMUST00000135490

SMART Domains

Protein: ENSMUSP00000116964
Gene: ENSMUSG00000034930

Domain	Start	End	E-Value	Type
Blast:Hr1	1	49	2e-25	BLAST
Pfam:Anillin	66	221	1.8e-25	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144723

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146969

Predicted Effect

probably benign
Transcript: ENSMUST00000153148

SMART Domains

Protein: ENSMUSP00000116608
Gene: ENSMUSG00000030032

Domain	Start	End	E-Value	Type
low complexity region	12	22	N/A	INTRINSIC
WD40	153	197	5.92e1	SMART
WD40	201	238	3.55e1	SMART
WD40	241	280	1.79e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154625

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203183

Predicted Effect

probably benign
Transcript: ENSMUST00000213056

Meta Mutation Damage Score

0.0590

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

96% (73/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that interacts with GTP-bound Rho proteins. Binding of this protein inhibits the GTPase activity of Rho proteins. This protein may interfere with the conversion of active, GTP-bound Rho to the inactive GDP-bound form by RhoGAP. Rho proteins regulate many important cellular processes, including cytokinesis, transcription, smooth muscle contraction, cell growth and transformation. Dysregulation of the Rho signal transduction pathway has been implicated in many forms of cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,373,323	F3387I	possibly damaging	Het
Acacb	T	A	5: 114,166,027	S170R	probably benign	Het
Adamtsl4	A	G	3: 95,681,650		probably null	Het
Adgrv1	A	G	13: 81,488,931	C3464R	probably benign	Het
Apbb1	A	T	7: 105,565,682		probably benign	Het
Cad	A	G	5: 31,055,021	T23A	probably benign	Het
Cdca7	A	G	2: 72,483,415	R183G	probably benign	Het
Cdpf1	T	C	15: 85,809,312	T5A	probably benign	Het
Cep85	T	C	4: 134,156,179	D133G	probably damaging	Het
Chrna9	T	C	5: 65,971,016	L189P	probably damaging	Het
Clca1	A	C	3: 145,007,928		probably null	Het
Cntn1	G	T	15: 92,242,995	V201F	probably damaging	Het
Col4a3	A	G	1: 82,666,546	E352G	unknown	Het
Ddhd2	T	C	8: 25,752,137	Y237C	probably damaging	Het
Dnah6	A	C	6: 73,037,622	F3609V	probably benign	Het
Epha3	T	C	16: 63,602,287	K580R	possibly damaging	Het
Fam135b	T	C	15: 71,462,711	N878S	probably benign	Het
Fam71e2	T	C	7: 4,758,661	N351D	probably benign	Het
Fbn1	T	G	2: 125,329,102	T1938P	probably damaging	Het
Foxg1	T	C	12: 49,385,186	V234A	probably damaging	Het
Glt1d1	A	T	5: 127,644,414	N55I	probably benign	Het
Gm17641	C	A	3: 68,869,474		probably benign	Het
Gm7665	A	G	18: 16,274,731		noncoding transcript	Het
Hgf	A	C	5: 16,614,894	N541T	probably benign	Het
Hipk2	G	A	6: 38,818,879	P152S	probably benign	Het
Jarid2	C	T	13: 44,906,565	L720F	probably damaging	Het
Kifc5b	A	G	17: 26,924,787	E511G	probably damaging	Het
Ldlr	G	A	9: 21,735,242	A235T	probably benign	Het
Lmln	A	G	16: 33,074,180	D231G	possibly damaging	Het
Lrp1	A	G	10: 127,567,495	C2070R	probably damaging	Het
Mbl1	A	G	14: 41,158,724	T190A	possibly damaging	Het
Mpdz	A	T	4: 81,381,697	S355T	probably benign	Het
Muc19	C	T	15: 91,888,138		noncoding transcript	Het
Mycbp2	A	C	14: 103,139,235		probably null	Het
Naa20	T	C	2: 145,915,842	S164P	probably damaging	Het
Nme4	A	T	17: 26,093,833		probably benign	Het
Npas2	A	T	1: 39,347,506	R619*	probably null	Het
Nudt19	G	A	7: 35,555,746	T20I	possibly damaging	Het
Olfr1224-ps1	T	A	2: 89,156,939	K79*	probably null	Het
Olfr1447	A	G	19: 12,901,001	Y260H	probably damaging	Het
Pitpnc1	A	G	11: 107,296,228	Y90H	possibly damaging	Het
Rcor2	A	G	19: 7,269,785	T6A	probably benign	Het
Rif1	T	A	2: 52,109,928	S1131R	probably damaging	Het
Rtn4rl2	T	A	2: 84,872,502	N242I	probably damaging	Het
Sbno2	G	A	10: 80,062,188	L719F	probably benign	Het
Scn11a	G	T	9: 119,819,831	D55E	probably damaging	Het
Setd1b	T	A	5: 123,151,866	I632N	unknown	Het
Spaca6	A	G	17: 17,831,196	T45A	probably benign	Het
Srpk2	A	T	5: 23,524,392	D416E	possibly damaging	Het
Sspo	A	T	6: 48,466,955		probably null	Het
Sycp1	A	T	3: 102,845,054	I804N	probably benign	Het
Tdp2	G	A	13: 24,831,826	R32Q	probably benign	Het
Tgfbr3	A	G	5: 107,136,929	V618A	possibly damaging	Het
Tmc3	C	T	7: 83,609,118	P439S	probably benign	Het
Tnxb	A	T	17: 34,717,483	D2740V	probably damaging	Het
Tspyl4	A	G	10: 34,297,937	T142A	probably benign	Het
Ttn	T	C	2: 76,880,441		probably benign	Het
Tubgcp4	T	C	2: 121,173,580	L34P	probably damaging	Het
Tubgcp6	G	T	15: 89,099,545		probably benign	Het
Unc79	T	A	12: 103,112,703	V1690E	probably benign	Het
Vps4b	T	C	1: 106,796,418		probably null	Het
Wtap	A	G	17: 12,967,638	S341P	possibly damaging	Het
Wwc1	T	C	11: 35,883,345	T363A	probably benign	Het
Zbtb8a	G	A	4: 129,360,500	T67M	probably damaging	Het
Zfp865	T	C	7: 5,034,669		probably benign	Het

Other mutations in Rtkn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01538:Rtkn	APN	6	83146061	missense	probably damaging	1.00
IGL02265:Rtkn	APN	6	83147542	missense	probably damaging	1.00
IGL02551:Rtkn	APN	6	83151924	missense	probably damaging	1.00
IGL03028:Rtkn	APN	6	83147872	nonsense	probably null
IGL03388:Rtkn	APN	6	83150090	missense	probably benign	0.02
R1648:Rtkn	UTSW	6	83135994	missense	probably damaging	1.00
R2100:Rtkn	UTSW	6	83149560	unclassified	probably null
R2517:Rtkn	UTSW	6	83147545	missense	probably damaging	1.00
R3608:Rtkn	UTSW	6	83150035	missense	probably damaging	0.97
R3946:Rtkn	UTSW	6	83135976	missense	probably benign	0.01
R4170:Rtkn	UTSW	6	83142395	start codon destroyed	probably null
R4630:Rtkn	UTSW	6	83152182	nonsense	probably null
R5102:Rtkn	UTSW	6	83149773	missense	probably damaging	0.98
R6165:Rtkn	UTSW	6	83145963	missense	probably damaging	1.00
R6372:Rtkn	UTSW	6	83151901	missense	possibly damaging	0.96
R7101:Rtkn	UTSW	6	83150012	missense	possibly damaging	0.76
R7155:Rtkn	UTSW	6	83149711	missense	probably damaging	0.99
R7251:Rtkn	UTSW	6	83135962	missense	probably damaging	1.00
R7381:Rtkn	UTSW	6	83151745	missense	probably damaging	0.97
R7598:Rtkn	UTSW	6	83147903	missense	probably null	0.96
R7624:Rtkn	UTSW	6	83152177	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCGGAAGTCCCAAAGGTAC -3'
(R):5'- GATCTTCATGACTTCATCACAACAGTG -3'

Sequencing Primer
(F):5'- AGGTACTGCTAGGCCAGTCTAG -3'
(R):5'- GAGGACCAGACCCATGCAG -3'

Posted On

2016-06-15