Incidental Mutation 'R5044:Ddhd2'
ID 394261
Institutional Source Beutler Lab
Gene Symbol Ddhd2
Ensembl Gene ENSMUSG00000061313
Gene Name DDHD domain containing 2
Synonyms 2010305K11Rik, SAMWD1
MMRRC Submission 042634-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock # R5044 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 25725346-25754596 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25752137 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 237 (Y237C)
Ref Sequence ENSEMBL: ENSMUSP00000147859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033975] [ENSMUST00000211009] [ENSMUST00000211688] [ENSMUST00000211751]
AlphaFold Q80Y98
Predicted Effect probably damaging
Transcript: ENSMUST00000033975
AA Change: Y125C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033975
Gene: ENSMUSG00000061313
AA Change: Y125C

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Pfam:WWE 40 112 7.5e-9 PFAM
Blast:DDHD 285 357 6e-28 BLAST
SAM 382 447 1.13e-11 SMART
DDHD 484 688 6.63e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167899
SMART Domains Protein: ENSMUSP00000130277
Gene: ENSMUSG00000091514

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209419
Predicted Effect unknown
Transcript: ENSMUST00000210888
AA Change: Y107C
Predicted Effect probably damaging
Transcript: ENSMUST00000211009
AA Change: Y125C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000211688
AA Change: Y237C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000211751
Meta Mutation Damage Score 0.4355 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme containing sterile-alpha-motif (SAM), WWE, and DDHD domains. This protein participates in membrane trafficking between the endoplastic reticulum and the Golgi body. Mutations in this gene can cause autosomal recessive spastic paraplegia 54. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a null mutation display impaired balance and coordination, impaired spatial learning and memory and triglyceride accumulation in neurons in the brain and spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,323 F3387I possibly damaging Het
Acacb T A 5: 114,166,027 S170R probably benign Het
Adamtsl4 A G 3: 95,681,650 probably null Het
Adgrv1 A G 13: 81,488,931 C3464R probably benign Het
Apbb1 A T 7: 105,565,682 probably benign Het
Cad A G 5: 31,055,021 T23A probably benign Het
Cdca7 A G 2: 72,483,415 R183G probably benign Het
Cdpf1 T C 15: 85,809,312 T5A probably benign Het
Cep85 T C 4: 134,156,179 D133G probably damaging Het
Chrna9 T C 5: 65,971,016 L189P probably damaging Het
Clca1 A C 3: 145,007,928 probably null Het
Cntn1 G T 15: 92,242,995 V201F probably damaging Het
Col4a3 A G 1: 82,666,546 E352G unknown Het
Dnah6 A C 6: 73,037,622 F3609V probably benign Het
Epha3 T C 16: 63,602,287 K580R possibly damaging Het
Fam135b T C 15: 71,462,711 N878S probably benign Het
Fam71e2 T C 7: 4,758,661 N351D probably benign Het
Fbn1 T G 2: 125,329,102 T1938P probably damaging Het
Foxg1 T C 12: 49,385,186 V234A probably damaging Het
Glt1d1 A T 5: 127,644,414 N55I probably benign Het
Gm17641 C A 3: 68,869,474 probably benign Het
Gm7665 A G 18: 16,274,731 noncoding transcript Het
Hgf A C 5: 16,614,894 N541T probably benign Het
Hipk2 G A 6: 38,818,879 P152S probably benign Het
Jarid2 C T 13: 44,906,565 L720F probably damaging Het
Kifc5b A G 17: 26,924,787 E511G probably damaging Het
Ldlr G A 9: 21,735,242 A235T probably benign Het
Lmln A G 16: 33,074,180 D231G possibly damaging Het
Lrp1 A G 10: 127,567,495 C2070R probably damaging Het
Mbl1 A G 14: 41,158,724 T190A possibly damaging Het
Mpdz A T 4: 81,381,697 S355T probably benign Het
Muc19 C T 15: 91,888,138 noncoding transcript Het
Mycbp2 A C 14: 103,139,235 probably null Het
Naa20 T C 2: 145,915,842 S164P probably damaging Het
Nme4 A T 17: 26,093,833 probably benign Het
Npas2 A T 1: 39,347,506 R619* probably null Het
Nudt19 G A 7: 35,555,746 T20I possibly damaging Het
Olfr1224-ps1 T A 2: 89,156,939 K79* probably null Het
Olfr1447 A G 19: 12,901,001 Y260H probably damaging Het
Pitpnc1 A G 11: 107,296,228 Y90H possibly damaging Het
Rcor2 A G 19: 7,269,785 T6A probably benign Het
Rif1 T A 2: 52,109,928 S1131R probably damaging Het
Rtkn T A 6: 83,150,991 D377E probably benign Het
Rtn4rl2 T A 2: 84,872,502 N242I probably damaging Het
Sbno2 G A 10: 80,062,188 L719F probably benign Het
Scn11a G T 9: 119,819,831 D55E probably damaging Het
Setd1b T A 5: 123,151,866 I632N unknown Het
Spaca6 A G 17: 17,831,196 T45A probably benign Het
Srpk2 A T 5: 23,524,392 D416E possibly damaging Het
Sspo A T 6: 48,466,955 probably null Het
Sycp1 A T 3: 102,845,054 I804N probably benign Het
Tdp2 G A 13: 24,831,826 R32Q probably benign Het
Tgfbr3 A G 5: 107,136,929 V618A possibly damaging Het
Tmc3 C T 7: 83,609,118 P439S probably benign Het
Tnxb A T 17: 34,717,483 D2740V probably damaging Het
Tspyl4 A G 10: 34,297,937 T142A probably benign Het
Ttn T C 2: 76,880,441 probably benign Het
Tubgcp4 T C 2: 121,173,580 L34P probably damaging Het
Tubgcp6 G T 15: 89,099,545 probably benign Het
Unc79 T A 12: 103,112,703 V1690E probably benign Het
Vps4b T C 1: 106,796,418 probably null Het
Wtap A G 17: 12,967,638 S341P possibly damaging Het
Wwc1 T C 11: 35,883,345 T363A probably benign Het
Zbtb8a G A 4: 129,360,500 T67M probably damaging Het
Zfp865 T C 7: 5,034,669 probably benign Het
Other mutations in Ddhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01501:Ddhd2 APN 8 25735830 missense probably damaging 1.00
IGL01629:Ddhd2 APN 8 25735828 missense possibly damaging 0.91
IGL01656:Ddhd2 APN 8 25727712 missense probably benign 0.34
IGL01723:Ddhd2 APN 8 25735011 nonsense probably null
IGL01820:Ddhd2 APN 8 25749754 missense possibly damaging 0.87
IGL01901:Ddhd2 APN 8 25748594 missense probably damaging 0.96
IGL02619:Ddhd2 APN 8 25746954 critical splice acceptor site probably null
PIT4362001:Ddhd2 UTSW 8 25735752 missense probably damaging 1.00
R0240:Ddhd2 UTSW 8 25739590 splice site probably null
R0240:Ddhd2 UTSW 8 25739590 splice site probably null
R0408:Ddhd2 UTSW 8 25739587 critical splice acceptor site probably null
R0732:Ddhd2 UTSW 8 25741321 missense probably damaging 1.00
R1483:Ddhd2 UTSW 8 25753128 missense probably benign 0.01
R1597:Ddhd2 UTSW 8 25749741 missense probably benign 0.09
R1881:Ddhd2 UTSW 8 25727700 missense probably damaging 0.99
R1927:Ddhd2 UTSW 8 25741661 missense possibly damaging 0.92
R2044:Ddhd2 UTSW 8 25752165 missense probably damaging 1.00
R4494:Ddhd2 UTSW 8 25738234 missense probably benign 0.01
R4728:Ddhd2 UTSW 8 25752267 missense probably damaging 1.00
R5138:Ddhd2 UTSW 8 25727699 missense probably damaging 1.00
R5529:Ddhd2 UTSW 8 25739560 missense probably benign 0.00
R5761:Ddhd2 UTSW 8 25741699 missense probably benign 0.19
R5799:Ddhd2 UTSW 8 25748602 missense probably damaging 1.00
R5934:Ddhd2 UTSW 8 25753113 missense probably damaging 1.00
R5965:Ddhd2 UTSW 8 25735777 missense probably damaging 1.00
R5988:Ddhd2 UTSW 8 25748562 missense probably damaging 1.00
R6260:Ddhd2 UTSW 8 25752117 missense probably benign 0.00
R6791:Ddhd2 UTSW 8 25752215 missense probably benign 0.04
R7386:Ddhd2 UTSW 8 25754290 missense possibly damaging 0.53
R7470:Ddhd2 UTSW 8 25735060 missense probably benign 0.06
R7911:Ddhd2 UTSW 8 25748536 critical splice donor site probably null
R8153:Ddhd2 UTSW 8 25750789 missense probably benign 0.16
R8385:Ddhd2 UTSW 8 25735014 missense probably damaging 0.99
R9190:Ddhd2 UTSW 8 25754467 missense probably benign 0.18
R9381:Ddhd2 UTSW 8 25749822 missense probably benign 0.17
Z1176:Ddhd2 UTSW 8 25735829 missense possibly damaging 0.61
Z1177:Ddhd2 UTSW 8 25754374 missense probably benign
Z1177:Ddhd2 UTSW 8 25754385 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGAAACTAGCCTGCAGAGAG -3'
(R):5'- GGACTGTAACTTACAAGTGTATTTGGG -3'

Sequencing Primer
(F):5'- ACTAGCCTGCAGAGAGAAATTAC -3'
(R):5'- AGAGTTGTTGTGACATAGTGGAC -3'
Posted On 2016-06-15