Mutagenetix > Incidental Mutation

Incidental Mutation 'R5044:Ldlr'

394262

Institutional Source

Beutler Lab

Gene Symbol

Ldlr

Ensembl Gene

ENSMUSG00000032193

Gene Name

low density lipoprotein receptor

Synonyms

MMRRC Submission

042634-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5044 (G1)

Quality Score

166

Status

Validated

Chromosome

Chromosomal Location

21723483-21749919 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 21735242 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 235 (A235T)

Ref Sequence

ENSEMBL: ENSMUSP00000149431 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034713] [ENSMUST00000213114]

AlphaFold

P35951

Predicted Effect

probably benign
Transcript: ENSMUST00000034713
AA Change: A235T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000034713
Gene: ENSMUSG00000032193
AA Change: A235T

Domain	Start	End	E-Value	Type
low complexity region	13	23	N/A	INTRINSIC
LDLa	26	65	1.89e-14	SMART
LDLa	67	106	9.81e-13	SMART
EGF_like	108	144	6.81e1	SMART
LDLa	108	145	3.77e-14	SMART
LDLa	147	186	6.67e-15	SMART
LDLa	197	234	1.16e-14	SMART
LDLa	236	273	3.24e-13	SMART
LDLa	276	316	1e-9	SMART
EGF	318	354	3.2e-4	SMART
EGF_CA	355	394	4.09e-11	SMART
LY	420	462	1.11e-3	SMART
LY	466	508	4.7e-11	SMART
LY	509	552	5.23e-9	SMART
LY	553	595	7.86e-13	SMART
LY	596	639	3.25e-5	SMART
EGF	666	713	7.64e-2	SMART
low complexity region	799	811	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000213114
AA Change: A235T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214359

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215917

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217111

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217613

Meta Mutation Damage Score

0.1949

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

96% (73/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. Low density lipoprotein (LDL) is normally bound at the cell membrane and taken into the cell ending up in lysosomes where the protein is degraded and the cholesterol is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous targeted mutants exhibit 2X higher total plasma cholesterol and 7-9X higher IDL and LDL levels on a normal diet compared to controls. On a high cholesterol diet, mutant effects dramatically increase and mice develop xanthomatosis and atherosclerosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,373,323	F3387I	possibly damaging	Het
Acacb	T	A	5: 114,166,027	S170R	probably benign	Het
Adamtsl4	A	G	3: 95,681,650		probably null	Het
Adgrv1	A	G	13: 81,488,931	C3464R	probably benign	Het
Apbb1	A	T	7: 105,565,682		probably benign	Het
Cad	A	G	5: 31,055,021	T23A	probably benign	Het
Cdca7	A	G	2: 72,483,415	R183G	probably benign	Het
Cdpf1	T	C	15: 85,809,312	T5A	probably benign	Het
Cep85	T	C	4: 134,156,179	D133G	probably damaging	Het
Chrna9	T	C	5: 65,971,016	L189P	probably damaging	Het
Clca1	A	C	3: 145,007,928		probably null	Het
Cntn1	G	T	15: 92,242,995	V201F	probably damaging	Het
Col4a3	A	G	1: 82,666,546	E352G	unknown	Het
Ddhd2	T	C	8: 25,752,137	Y237C	probably damaging	Het
Dnah6	A	C	6: 73,037,622	F3609V	probably benign	Het
Epha3	T	C	16: 63,602,287	K580R	possibly damaging	Het
Fam135b	T	C	15: 71,462,711	N878S	probably benign	Het
Fam71e2	T	C	7: 4,758,661	N351D	probably benign	Het
Fbn1	T	G	2: 125,329,102	T1938P	probably damaging	Het
Foxg1	T	C	12: 49,385,186	V234A	probably damaging	Het
Glt1d1	A	T	5: 127,644,414	N55I	probably benign	Het
Gm17641	C	A	3: 68,869,474		probably benign	Het
Gm7665	A	G	18: 16,274,731		noncoding transcript	Het
Hgf	A	C	5: 16,614,894	N541T	probably benign	Het
Hipk2	G	A	6: 38,818,879	P152S	probably benign	Het
Jarid2	C	T	13: 44,906,565	L720F	probably damaging	Het
Kifc5b	A	G	17: 26,924,787	E511G	probably damaging	Het
Lmln	A	G	16: 33,074,180	D231G	possibly damaging	Het
Lrp1	A	G	10: 127,567,495	C2070R	probably damaging	Het
Mbl1	A	G	14: 41,158,724	T190A	possibly damaging	Het
Mpdz	A	T	4: 81,381,697	S355T	probably benign	Het
Muc19	C	T	15: 91,888,138		noncoding transcript	Het
Mycbp2	A	C	14: 103,139,235		probably null	Het
Naa20	T	C	2: 145,915,842	S164P	probably damaging	Het
Nme4	A	T	17: 26,093,833		probably benign	Het
Npas2	A	T	1: 39,347,506	R619*	probably null	Het
Nudt19	G	A	7: 35,555,746	T20I	possibly damaging	Het
Olfr1224-ps1	T	A	2: 89,156,939	K79*	probably null	Het
Olfr1447	A	G	19: 12,901,001	Y260H	probably damaging	Het
Pitpnc1	A	G	11: 107,296,228	Y90H	possibly damaging	Het
Rcor2	A	G	19: 7,269,785	T6A	probably benign	Het
Rif1	T	A	2: 52,109,928	S1131R	probably damaging	Het
Rtkn	T	A	6: 83,150,991	D377E	probably benign	Het
Rtn4rl2	T	A	2: 84,872,502	N242I	probably damaging	Het
Sbno2	G	A	10: 80,062,188	L719F	probably benign	Het
Scn11a	G	T	9: 119,819,831	D55E	probably damaging	Het
Setd1b	T	A	5: 123,151,866	I632N	unknown	Het
Spaca6	A	G	17: 17,831,196	T45A	probably benign	Het
Srpk2	A	T	5: 23,524,392	D416E	possibly damaging	Het
Sspo	A	T	6: 48,466,955		probably null	Het
Sycp1	A	T	3: 102,845,054	I804N	probably benign	Het
Tdp2	G	A	13: 24,831,826	R32Q	probably benign	Het
Tgfbr3	A	G	5: 107,136,929	V618A	possibly damaging	Het
Tmc3	C	T	7: 83,609,118	P439S	probably benign	Het
Tnxb	A	T	17: 34,717,483	D2740V	probably damaging	Het
Tspyl4	A	G	10: 34,297,937	T142A	probably benign	Het
Ttn	T	C	2: 76,880,441		probably benign	Het
Tubgcp4	T	C	2: 121,173,580	L34P	probably damaging	Het
Tubgcp6	G	T	15: 89,099,545		probably benign	Het
Unc79	T	A	12: 103,112,703	V1690E	probably benign	Het
Vps4b	T	C	1: 106,796,418		probably null	Het
Wtap	A	G	17: 12,967,638	S341P	possibly damaging	Het
Wwc1	T	C	11: 35,883,345	T363A	probably benign	Het
Zbtb8a	G	A	4: 129,360,500	T67M	probably damaging	Het
Zfp865	T	C	7: 5,034,669		probably benign	Het

Other mutations in Ldlr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Ldlr	APN	9	21735361	critical splice donor site	probably null
IGL01975:Ldlr	APN	9	21733697	missense	probably benign	0.05
IGL02043:Ldlr	APN	9	21733499	missense	probably benign	0.03
IGL02524:Ldlr	APN	9	21733681	missense	probably damaging	1.00
IGL03049:Ldlr	APN	9	21745819	missense	probably benign	0.00
IGL03113:Ldlr	APN	9	21739828	missense	possibly damaging	0.85
R0240:Ldlr	UTSW	9	21737999	splice site	probably benign
R0586:Ldlr	UTSW	9	21739744	missense	probably benign	0.00
R1398:Ldlr	UTSW	9	21739542	missense	probably benign	0.01
R1587:Ldlr	UTSW	9	21737913	missense	probably damaging	0.99
R2198:Ldlr	UTSW	9	21732402	missense	probably damaging	1.00
R3730:Ldlr	UTSW	9	21731801	missense	probably benign	0.09
R4422:Ldlr	UTSW	9	21737952	missense	probably damaging	1.00
R5046:Ldlr	UTSW	9	21745907	critical splice donor site	probably null
R6186:Ldlr	UTSW	9	21723759	start gained	probably benign
R6195:Ldlr	UTSW	9	21731781	nonsense	probably null
R6523:Ldlr	UTSW	9	21737253	missense	probably damaging	1.00
R6682:Ldlr	UTSW	9	21732375	missense	probably benign
R7256:Ldlr	UTSW	9	21745744	missense	probably benign	0.01
R7384:Ldlr	UTSW	9	21739794	missense	probably benign	0.07
R7823:Ldlr	UTSW	9	21742306	critical splice donor site	probably null
R8065:Ldlr	UTSW	9	21737945	missense	probably damaging	1.00
R8223:Ldlr	UTSW	9	21747250	missense	probably damaging	1.00
R8732:Ldlr	UTSW	9	21739689	missense	probably benign	0.00
R8931:Ldlr	UTSW	9	21731812	missense	probably damaging	0.99
R8954:Ldlr	UTSW	9	21739532	missense	possibly damaging	0.87
R9315:Ldlr	UTSW	9	21733486	splice site	probably benign
R9489:Ldlr	UTSW	9	21735330	missense	probably damaging	1.00
R9517:Ldlr	UTSW	9	21743944	missense	possibly damaging	0.90
R9605:Ldlr	UTSW	9	21735330	missense	probably damaging	1.00
R9709:Ldlr	UTSW	9	21745839	missense	probably benign	0.00
X0024:Ldlr	UTSW	9	21739818	missense	probably damaging	1.00
Z1177:Ldlr	UTSW	9	21739830	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATCCCCTGCGTGATTTAGTG -3'
(R):5'- TTTACAGAAATGCAAGGCACTGAG -3'

Sequencing Primer
(F):5'- GCAGCTCCTGACAGTGAG -3'
(R):5'- GCACTGAGAAGTGGGACC -3'

Posted On

2016-06-15