Mutagenetix > Incidental Mutations

Incidental Mutation 'R5044:Sbno2'

394265

Institutional Source

Beutler Lab

Gene Symbol

Sbno2

Ensembl Gene

ENSMUSG00000035673

Gene Name

strawberry notch 2

Synonyms

Stno

MMRRC Submission

042634-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.507) question?

Stock #

R5044 (G1)

Quality Score

205

Status

Validated

Chromosome

Chromosomal Location

80056992-80105571 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 80062188 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 719 (L719F)

Ref Sequence

ENSEMBL: ENSMUSP00000151449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042771] [ENSMUST00000217972] [ENSMUST00000218630] [ENSMUST00000219260]

Predicted Effect

probably benign
Transcript: ENSMUST00000042771
AA Change: L735F

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000041635
Gene: ENSMUSG00000035673
AA Change: L735F

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
low complexity region	177	189	N/A	INTRINSIC
Pfam:AAA_34	209	500	8.2e-135	PFAM
Pfam:ResIII	239	419	7.7e-8	PFAM
low complexity region	611	631	N/A	INTRINSIC
Pfam:Helicase_C_4	726	1004	7.5e-120	PFAM
low complexity region	1263	1283	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217876

Predicted Effect

probably benign
Transcript: ENSMUST00000217972
AA Change: L719F

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218462

Predicted Effect

probably benign
Transcript: ENSMUST00000218630
AA Change: L735F

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

Predicted Effect

probably benign
Transcript: ENSMUST00000219260
AA Change: L735F

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

96% (73/76)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired osteoclast fusion, impaired osteoblastogenesis, osteopetrosis, increased bone mass, and decreased body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,373,323	F3387I	possibly damaging	Het
Acacb	T	A	5: 114,166,027	S170R	probably benign	Het
Adamtsl4	A	G	3: 95,681,650		probably null	Het
Adgrv1	A	G	13: 81,488,931	C3464R	probably benign	Het
Apbb1	A	T	7: 105,565,682		probably benign	Het
Cad	A	G	5: 31,055,021	T23A	probably benign	Het
Cdca7	A	G	2: 72,483,415	R183G	probably benign	Het
Cdpf1	T	C	15: 85,809,312	T5A	probably benign	Het
Cep85	T	C	4: 134,156,179	D133G	probably damaging	Het
Chrna9	T	C	5: 65,971,016	L189P	probably damaging	Het
Clca1	A	C	3: 145,007,928		probably null	Het
Cntn1	G	T	15: 92,242,995	V201F	probably damaging	Het
Col4a3	A	G	1: 82,666,546	E352G	unknown	Het
Ddhd2	T	C	8: 25,752,137	Y237C	probably damaging	Het
Dnah6	A	C	6: 73,037,622	F3609V	probably benign	Het
Epha3	T	C	16: 63,602,287	K580R	possibly damaging	Het
Fam135b	T	C	15: 71,462,711	N878S	probably benign	Het
Fam71e2	T	C	7: 4,758,661	N351D	probably benign	Het
Fbn1	T	G	2: 125,329,102	T1938P	probably damaging	Het
Foxg1	T	C	12: 49,385,186	V234A	probably damaging	Het
Glt1d1	A	T	5: 127,644,414	N55I	probably benign	Het
Gm17641	C	A	3: 68,869,474		probably benign	Het
Gm7665	A	G	18: 16,274,731		noncoding transcript	Het
Hgf	A	C	5: 16,614,894	N541T	probably benign	Het
Hipk2	G	A	6: 38,818,879	P152S	probably benign	Het
Jarid2	C	T	13: 44,906,565	L720F	probably damaging	Het
Kifc5b	A	G	17: 26,924,787	E511G	probably damaging	Het
Ldlr	G	A	9: 21,735,242	A235T	probably benign	Het
Lmln	A	G	16: 33,074,180	D231G	possibly damaging	Het
Lrp1	A	G	10: 127,567,495	C2070R	probably damaging	Het
Mbl1	A	G	14: 41,158,724	T190A	possibly damaging	Het
Mpdz	A	T	4: 81,381,697	S355T	probably benign	Het
Muc19	C	T	15: 91,888,138		noncoding transcript	Het
Mycbp2	A	C	14: 103,139,235		probably null	Het
Naa20	T	C	2: 145,915,842	S164P	probably damaging	Het
Nme4	A	T	17: 26,093,833		probably benign	Het
Npas2	A	T	1: 39,347,506	R619*	probably null	Het
Nudt19	G	A	7: 35,555,746	T20I	possibly damaging	Het
Olfr1224-ps1	T	A	2: 89,156,939	K79*	probably null	Het
Olfr1447	A	G	19: 12,901,001	Y260H	probably damaging	Het
Pitpnc1	A	G	11: 107,296,228	Y90H	possibly damaging	Het
Rcor2	A	G	19: 7,269,785	T6A	probably benign	Het
Rif1	T	A	2: 52,109,928	S1131R	probably damaging	Het
Rtkn	T	A	6: 83,150,991	D377E	probably benign	Het
Rtn4rl2	T	A	2: 84,872,502	N242I	probably damaging	Het
Scn11a	G	T	9: 119,819,831	D55E	probably damaging	Het
Setd1b	T	A	5: 123,151,866	I632N	unknown	Het
Spaca6	A	G	17: 17,831,196	T45A	probably benign	Het
Srpk2	A	T	5: 23,524,392	D416E	possibly damaging	Het
Sspo	A	T	6: 48,466,955		probably null	Het
Sycp1	A	T	3: 102,845,054	I804N	probably benign	Het
Tdp2	G	A	13: 24,831,826	R32Q	probably benign	Het
Tgfbr3	A	G	5: 107,136,929	V618A	possibly damaging	Het
Tmc3	C	T	7: 83,609,118	P439S	probably benign	Het
Tnxb	A	T	17: 34,717,483	D2740V	probably damaging	Het
Tspyl4	A	G	10: 34,297,937	T142A	probably benign	Het
Ttn	T	C	2: 76,880,441		probably benign	Het
Tubgcp4	T	C	2: 121,173,580	L34P	probably damaging	Het
Tubgcp6	G	T	15: 89,099,545		probably benign	Het
Unc79	T	A	12: 103,112,703	V1690E	probably benign	Het
Vps4b	T	C	1: 106,796,418		probably null	Het
Wtap	A	G	17: 12,967,638	S341P	possibly damaging	Het
Wwc1	T	C	11: 35,883,345	T363A	probably benign	Het
Zbtb8a	G	A	4: 129,360,500	T67M	probably damaging	Het
Zfp865	T	C	7: 5,034,669		probably benign	Het

Other mutations in Sbno2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Sbno2	APN	10	80064506	splice site	probably benign
IGL01773:Sbno2	APN	10	80057831	missense	probably damaging	1.00
IGL01869:Sbno2	APN	10	80060392	critical splice donor site	probably null
IGL01911:Sbno2	APN	10	80069624	nonsense	probably null
IGL02071:Sbno2	APN	10	80060641	missense	probably damaging	1.00
IGL02094:Sbno2	APN	10	80057645	missense	probably benign
IGL02220:Sbno2	APN	10	80072368	missense	probably benign	0.04
IGL02366:Sbno2	APN	10	80064202	missense	probably damaging	1.00
IGL02608:Sbno2	APN	10	80067402	splice site	probably null
IGL03007:Sbno2	APN	10	80058550	splice site	probably benign
IGL03083:Sbno2	APN	10	80057534	missense	probably damaging	0.98
IGL03393:Sbno2	APN	10	80066901	missense	probably damaging	1.00
R0034:Sbno2	UTSW	10	80058340	splice site	probably benign
R0126:Sbno2	UTSW	10	80068853	splice site	probably null
R0652:Sbno2	UTSW	10	80067294	missense	probably damaging	1.00
R0964:Sbno2	UTSW	10	80084259	missense	possibly damaging	0.75
R1571:Sbno2	UTSW	10	80060392	critical splice donor site	probably null
R1601:Sbno2	UTSW	10	80060492	missense	probably damaging	0.98
R1634:Sbno2	UTSW	10	80060634	missense	possibly damaging	0.73
R1733:Sbno2	UTSW	10	80058508	missense	possibly damaging	0.92
R1762:Sbno2	UTSW	10	80066606	missense	probably damaging	1.00
R1832:Sbno2	UTSW	10	80060605	nonsense	probably null
R1859:Sbno2	UTSW	10	80058639	nonsense	probably null
R2086:Sbno2	UTSW	10	80057856	missense	possibly damaging	0.89
R2136:Sbno2	UTSW	10	80062693	missense	probably damaging	1.00
R2360:Sbno2	UTSW	10	80058021	missense	possibly damaging	0.81
R4426:Sbno2	UTSW	10	80072358	missense	probably null	0.02
R4504:Sbno2	UTSW	10	80060492	missense	possibly damaging	0.46
R4692:Sbno2	UTSW	10	80086327	missense	possibly damaging	0.90
R5166:Sbno2	UTSW	10	80066928	nonsense	probably null
R5576:Sbno2	UTSW	10	80067337	missense	probably damaging	0.99
R5665:Sbno2	UTSW	10	80058453	missense	probably benign	0.00
R5709:Sbno2	UTSW	10	80086337	start codon destroyed	probably null	0.89
R5828:Sbno2	UTSW	10	80066590	missense	possibly damaging	0.84
R6192:Sbno2	UTSW	10	80060016	missense	probably damaging	0.99
R6971:Sbno2	UTSW	10	80060034	missense	possibly damaging	0.95
R7012:Sbno2	UTSW	10	80069518	intron	probably benign
R7082:Sbno2	UTSW	10	80060090	splice site	probably null
R7133:Sbno2	UTSW	10	80086312	missense	probably damaging	1.00
R7438:Sbno2	UTSW	10	80069575	missense	unknown
R7481:Sbno2	UTSW	10	80057499	missense	probably benign	0.11
R7746:Sbno2	UTSW	10	80058874	missense	probably damaging	0.99
X0026:Sbno2	UTSW	10	80057459	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- ATCTAGCAAGCCCTCTCCAG -3'
(R):5'- TCATCCTGGTCCTGCAAAG -3'

Sequencing Primer
(F):5'- GGATTTGAACTCAGGACCTCCAG -3'
(R):5'- TGGTCCTGCAAAGCCACCTC -3'

Posted On

2016-06-15