Mutagenetix > Incidental Mutations

Incidental Mutation 'R5044:Jarid2'

394272

Institutional Source

Beutler Lab

Gene Symbol

Jarid2

Ensembl Gene

ENSMUSG00000038518

Gene Name

jumonji, AT rich interactive domain 2

Synonyms

jumonji, Jmj

MMRRC Submission

042634-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5044 (G1)

Quality Score

116

Status

Validated

Chromosome

Chromosomal Location

44729474-44921643 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 44906565 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 720 (L720F)

Ref Sequence

ENSEMBL: ENSMUSP00000134630 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044608] [ENSMUST00000173246] [ENSMUST00000173367] [ENSMUST00000173704] [ENSMUST00000173906]

AlphaFold

Q62315

Predicted Effect

probably damaging
Transcript: ENSMUST00000044608
AA Change: L758F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037774
Gene: ENSMUSG00000038518
AA Change: L758F

Domain	Start	End	E-Value	Type
low complexity region	86	99	N/A	INTRINSIC
low complexity region	181	195	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
low complexity region	334	353	N/A	INTRINSIC
JmjN	554	595	1.77e-20	SMART
ARID	616	707	4.96e-24	SMART
BRIGHT	620	712	1.7e-29	SMART
low complexity region	791	800	N/A	INTRINSIC
JmjC	882	1046	1.04e-50	SMART
Pfam:zf-C5HC2	1137	1191	2.4e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000173246
AA Change: L758F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134205
Gene: ENSMUSG00000038518
AA Change: L758F

Domain	Start	End	E-Value	Type
low complexity region	86	99	N/A	INTRINSIC
low complexity region	181	195	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
low complexity region	334	353	N/A	INTRINSIC
JmjN	554	595	1.77e-20	SMART
ARID	616	707	4.96e-24	SMART
BRIGHT	620	712	1.7e-29	SMART
low complexity region	791	800	N/A	INTRINSIC
JmjC	882	1046	1.04e-50	SMART
Pfam:zf-C5HC2	1137	1191	2.4e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173367

SMART Domains

Protein: ENSMUSP00000134658
Gene: ENSMUSG00000038518

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
low complexity region	126	146	N/A	INTRINSIC
low complexity region	195	214	N/A	INTRINSIC
JmjN	415	456	1.77e-20	SMART
PDB:2RQ5\|A	476	507	3e-14	PDB
Blast:ARID	477	507	2e-14	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000173704
AA Change: L758F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134675
Gene: ENSMUSG00000038518
AA Change: L758F

Domain	Start	End	E-Value	Type
low complexity region	86	99	N/A	INTRINSIC
low complexity region	181	195	N/A	INTRINSIC
low complexity region	265	285	N/A	INTRINSIC
low complexity region	334	353	N/A	INTRINSIC
JmjN	554	595	1.77e-20	SMART
ARID	616	707	4.96e-24	SMART
BRIGHT	620	712	1.7e-29	SMART
low complexity region	791	800	N/A	INTRINSIC
JmjC	882	1046	1.04e-50	SMART
Pfam:zf-C5HC2	1137	1190	1e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000173906
AA Change: L720F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134630
Gene: ENSMUSG00000038518
AA Change: L720F

Domain	Start	End	E-Value	Type
low complexity region	48	61	N/A	INTRINSIC
low complexity region	143	157	N/A	INTRINSIC
low complexity region	227	247	N/A	INTRINSIC
low complexity region	296	315	N/A	INTRINSIC
JmjN	516	557	1.77e-20	SMART
ARID	578	669	4.96e-24	SMART
BRIGHT	582	674	1.7e-29	SMART
low complexity region	753	762	N/A	INTRINSIC
JmjC	844	1008	1.04e-50	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174683

Meta Mutation Damage Score

0.1854

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

96% (73/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Jumonji- and AT-rich interaction domain (ARID)-domain-containing protein. The encoded protein is a DNA-binding protein that functions as a transcriptional repressor. This protein interacts with the Polycomb repressive complex 2 (PRC2) which plays an essential role in regulating gene expression during embryonic development. This protein facilitates the recruitment of the PRC2 complex to target genes. Alternate splicing results in multiple transcript variants. Mutations in this gene are associated with chronic myeloid malignancies. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutants show strain-specific phenotypes, including embryonic death and defective neural tube closure, impaired hematopoiesis and hypoplasia of liver, thymus and spleen. Homozygotes for another mutation die at birth with cardiac defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,373,323	F3387I	possibly damaging	Het
Acacb	T	A	5: 114,166,027	S170R	probably benign	Het
Adamtsl4	A	G	3: 95,681,650		probably null	Het
Adgrv1	A	G	13: 81,488,931	C3464R	probably benign	Het
Apbb1	A	T	7: 105,565,682		probably benign	Het
Cad	A	G	5: 31,055,021	T23A	probably benign	Het
Cdca7	A	G	2: 72,483,415	R183G	probably benign	Het
Cdpf1	T	C	15: 85,809,312	T5A	probably benign	Het
Cep85	T	C	4: 134,156,179	D133G	probably damaging	Het
Chrna9	T	C	5: 65,971,016	L189P	probably damaging	Het
Clca1	A	C	3: 145,007,928		probably null	Het
Cntn1	G	T	15: 92,242,995	V201F	probably damaging	Het
Col4a3	A	G	1: 82,666,546	E352G	unknown	Het
Ddhd2	T	C	8: 25,752,137	Y237C	probably damaging	Het
Dnah6	A	C	6: 73,037,622	F3609V	probably benign	Het
Epha3	T	C	16: 63,602,287	K580R	possibly damaging	Het
Fam135b	T	C	15: 71,462,711	N878S	probably benign	Het
Fam71e2	T	C	7: 4,758,661	N351D	probably benign	Het
Fbn1	T	G	2: 125,329,102	T1938P	probably damaging	Het
Foxg1	T	C	12: 49,385,186	V234A	probably damaging	Het
Glt1d1	A	T	5: 127,644,414	N55I	probably benign	Het
Gm17641	C	A	3: 68,869,474		probably benign	Het
Gm7665	A	G	18: 16,274,731		noncoding transcript	Het
Hgf	A	C	5: 16,614,894	N541T	probably benign	Het
Hipk2	G	A	6: 38,818,879	P152S	probably benign	Het
Kifc5b	A	G	17: 26,924,787	E511G	probably damaging	Het
Ldlr	G	A	9: 21,735,242	A235T	probably benign	Het
Lmln	A	G	16: 33,074,180	D231G	possibly damaging	Het
Lrp1	A	G	10: 127,567,495	C2070R	probably damaging	Het
Mbl1	A	G	14: 41,158,724	T190A	possibly damaging	Het
Mpdz	A	T	4: 81,381,697	S355T	probably benign	Het
Muc19	C	T	15: 91,888,138		noncoding transcript	Het
Mycbp2	A	C	14: 103,139,235		probably null	Het
Naa20	T	C	2: 145,915,842	S164P	probably damaging	Het
Nme4	A	T	17: 26,093,833		probably benign	Het
Npas2	A	T	1: 39,347,506	R619*	probably null	Het
Nudt19	G	A	7: 35,555,746	T20I	possibly damaging	Het
Olfr1224-ps1	T	A	2: 89,156,939	K79*	probably null	Het
Olfr1447	A	G	19: 12,901,001	Y260H	probably damaging	Het
Pitpnc1	A	G	11: 107,296,228	Y90H	possibly damaging	Het
Rcor2	A	G	19: 7,269,785	T6A	probably benign	Het
Rif1	T	A	2: 52,109,928	S1131R	probably damaging	Het
Rtkn	T	A	6: 83,150,991	D377E	probably benign	Het
Rtn4rl2	T	A	2: 84,872,502	N242I	probably damaging	Het
Sbno2	G	A	10: 80,062,188	L719F	probably benign	Het
Scn11a	G	T	9: 119,819,831	D55E	probably damaging	Het
Setd1b	T	A	5: 123,151,866	I632N	unknown	Het
Spaca6	A	G	17: 17,831,196	T45A	probably benign	Het
Srpk2	A	T	5: 23,524,392	D416E	possibly damaging	Het
Sspo	A	T	6: 48,466,955		probably null	Het
Sycp1	A	T	3: 102,845,054	I804N	probably benign	Het
Tdp2	G	A	13: 24,831,826	R32Q	probably benign	Het
Tgfbr3	A	G	5: 107,136,929	V618A	possibly damaging	Het
Tmc3	C	T	7: 83,609,118	P439S	probably benign	Het
Tnxb	A	T	17: 34,717,483	D2740V	probably damaging	Het
Tspyl4	A	G	10: 34,297,937	T142A	probably benign	Het
Ttn	T	C	2: 76,880,441		probably benign	Het
Tubgcp4	T	C	2: 121,173,580	L34P	probably damaging	Het
Tubgcp6	G	T	15: 89,099,545		probably benign	Het
Unc79	T	A	12: 103,112,703	V1690E	probably benign	Het
Vps4b	T	C	1: 106,796,418		probably null	Het
Wtap	A	G	17: 12,967,638	S341P	possibly damaging	Het
Wwc1	T	C	11: 35,883,345	T363A	probably benign	Het
Zbtb8a	G	A	4: 129,360,500	T67M	probably damaging	Het
Zfp865	T	C	7: 5,034,669		probably benign	Het

Other mutations in Jarid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01572:Jarid2	APN	13	44884835	missense	probably damaging	1.00
IGL02217:Jarid2	APN	13	44913201	missense	probably damaging	1.00
IGL02378:Jarid2	APN	13	44914325	missense	probably damaging	0.98
IGL02604:Jarid2	APN	13	44874401	missense	probably damaging	1.00
IGL02865:Jarid2	APN	13	44910560	missense	probably damaging	1.00
IGL02926:Jarid2	APN	13	44902929	missense	probably benign	0.03
R0057:Jarid2	UTSW	13	44884856	missense	probably damaging	0.96
R0426:Jarid2	UTSW	13	44840882	critical splice donor site	probably null
R0545:Jarid2	UTSW	13	44902831	missense	probably benign	0.10
R0562:Jarid2	UTSW	13	44902359	missense	probably damaging	0.99
R1192:Jarid2	UTSW	13	44906545	missense	probably damaging	1.00
R1241:Jarid2	UTSW	13	44884892	splice site	probably benign
R1254:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1464:Jarid2	UTSW	13	44848381	missense	probably damaging	0.97
R1464:Jarid2	UTSW	13	44848381	missense	probably damaging	0.97
R1552:Jarid2	UTSW	13	44911199	missense	probably damaging	1.00
R1728:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1729:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1730:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1739:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1783:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1785:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1844:Jarid2	UTSW	13	44902743	missense	possibly damaging	0.71
R1896:Jarid2	UTSW	13	44884882	critical splice donor site	probably null
R1965:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1966:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R1995:Jarid2	UTSW	13	44874441	missense	probably damaging	1.00
R2120:Jarid2	UTSW	13	44906336	missense	probably benign	0.17
R2142:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R2172:Jarid2	UTSW	13	44902539	missense	probably damaging	0.99
R2242:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R2245:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3110:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3111:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3112:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3115:Jarid2	UTSW	13	44896466	missense	probably damaging	1.00
R3620:Jarid2	UTSW	13	44906276	missense	probably damaging	1.00
R3704:Jarid2	UTSW	13	44902355	missense	probably benign
R3802:Jarid2	UTSW	13	44902831	missense	probably benign	0.10
R3804:Jarid2	UTSW	13	44902831	missense	probably benign	0.10
R4126:Jarid2	UTSW	13	44902256	missense	probably damaging	1.00
R4127:Jarid2	UTSW	13	44902256	missense	probably damaging	1.00
R4128:Jarid2	UTSW	13	44902256	missense	probably damaging	1.00
R4153:Jarid2	UTSW	13	44910426	missense	probably damaging	1.00
R4844:Jarid2	UTSW	13	44913772	missense	probably damaging	0.96
R5329:Jarid2	UTSW	13	44906271	missense	possibly damaging	0.49
R5632:Jarid2	UTSW	13	44896290	missense	probably damaging	0.97
R5820:Jarid2	UTSW	13	44902301	missense	possibly damaging	0.96
R6267:Jarid2	UTSW	13	44903063	missense	possibly damaging	0.93
R6296:Jarid2	UTSW	13	44903063	missense	possibly damaging	0.93
R6479:Jarid2	UTSW	13	44848289	missense	probably benign	0.22
R6619:Jarid2	UTSW	13	44874396	missense	probably damaging	1.00
R6633:Jarid2	UTSW	13	44884877	missense	probably damaging	0.97
R6970:Jarid2	UTSW	13	44902985	missense	probably damaging	1.00
R7020:Jarid2	UTSW	13	44884824	missense	probably damaging	1.00
R7155:Jarid2	UTSW	13	44902462	missense	probably damaging	1.00
R7223:Jarid2	UTSW	13	44896322	missense	possibly damaging	0.89
R7265:Jarid2	UTSW	13	44902272	missense	probably benign	0.29
R8321:Jarid2	UTSW	13	44848386	missense	probably damaging	0.96
R8872:Jarid2	UTSW	13	44902508	missense	possibly damaging	0.88
R9064:Jarid2	UTSW	13	44840850	missense
R9065:Jarid2	UTSW	13	44840850	missense
R9067:Jarid2	UTSW	13	44840850	missense
R9153:Jarid2	UTSW	13	44911202	missense	probably damaging	1.00
R9163:Jarid2	UTSW	13	44911251	missense	possibly damaging	0.92
R9468:Jarid2	UTSW	13	44919830	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGCGCATTCCCAAAACTG -3'
(R):5'- TCACCTTATAGATGCACTTGTGG -3'

Sequencing Primer
(F):5'- AAGCTGCAGGAGGCCTACTG -3'
(R):5'- CTTGTGGAAGTCATTGAGGACACC -3'

Posted On

2016-06-15