Mutagenetix > Incidental Mutations

Incidental Mutation 'R5044:Tubgcp6'

394278

Institutional Source

Beutler Lab

Gene Symbol

Tubgcp6

Ensembl Gene

ENSMUSG00000051786

Gene Name

tubulin, gamma complex associated protein 6

Synonyms

MMRRC Submission

042634-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R5044 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89098357-89123112 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to T at 89099545 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000082439] [ENSMUST00000109353] [ENSMUST00000130700] [ENSMUST00000166480]

AlphaFold

G5E8P0

Predicted Effect

probably benign
Transcript: ENSMUST00000041656

SMART Domains

Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786

Domain	Start	End	E-Value	Type
Pfam:Spc97_Spc98	355	1667	3.3e-119	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000082439

SMART Domains

Protein: ENSMUSP00000081020
Gene: ENSMUSG00000035757

Domain	Start	End	E-Value	Type
low complexity region	24	38	N/A	INTRINSIC
Pfam:UPF0061	79	625	8.3e-131	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109353

SMART Domains

Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786

Domain	Start	End	E-Value	Type
Pfam:Spc97_Spc98	355	1675	2.8e-94	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000130700

SMART Domains

Protein: ENSMUSP00000138382
Gene: ENSMUSG00000035757

Domain	Start	End	E-Value	Type
low complexity region	24	38	N/A	INTRINSIC
Pfam:UPF0061	80	241	1.5e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163290

SMART Domains

Protein: ENSMUSP00000131359
Gene: ENSMUSG00000051786

Domain	Start	End	E-Value	Type
Pfam:Spc97_Spc98	91	288	2.9e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164717

Predicted Effect

probably benign
Transcript: ENSMUST00000166480

SMART Domains

Protein: ENSMUSP00000132108
Gene: ENSMUSG00000051786

Domain	Start	End	E-Value	Type
Pfam:Spc97_Spc98	2	123	5e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166994

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168256

Predicted Effect

probably benign
Transcript: ENSMUST00000169069

SMART Domains

Protein: ENSMUSP00000132786
Gene: ENSMUSG00000051786

Domain	Start	End	E-Value	Type
coiled coil region	77	107	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169208

Predicted Effect

probably benign
Transcript: ENSMUST00000170877

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

96% (73/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large multisubunit complex required for microtubule nucleation at the centrosome. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,373,323	F3387I	possibly damaging	Het
Acacb	T	A	5: 114,166,027	S170R	probably benign	Het
Adamtsl4	A	G	3: 95,681,650		probably null	Het
Adgrv1	A	G	13: 81,488,931	C3464R	probably benign	Het
Apbb1	A	T	7: 105,565,682		probably benign	Het
Cad	A	G	5: 31,055,021	T23A	probably benign	Het
Cdca7	A	G	2: 72,483,415	R183G	probably benign	Het
Cdpf1	T	C	15: 85,809,312	T5A	probably benign	Het
Cep85	T	C	4: 134,156,179	D133G	probably damaging	Het
Chrna9	T	C	5: 65,971,016	L189P	probably damaging	Het
Clca1	A	C	3: 145,007,928		probably null	Het
Cntn1	G	T	15: 92,242,995	V201F	probably damaging	Het
Col4a3	A	G	1: 82,666,546	E352G	unknown	Het
Ddhd2	T	C	8: 25,752,137	Y237C	probably damaging	Het
Dnah6	A	C	6: 73,037,622	F3609V	probably benign	Het
Epha3	T	C	16: 63,602,287	K580R	possibly damaging	Het
Fam135b	T	C	15: 71,462,711	N878S	probably benign	Het
Fam71e2	T	C	7: 4,758,661	N351D	probably benign	Het
Fbn1	T	G	2: 125,329,102	T1938P	probably damaging	Het
Foxg1	T	C	12: 49,385,186	V234A	probably damaging	Het
Glt1d1	A	T	5: 127,644,414	N55I	probably benign	Het
Gm17641	C	A	3: 68,869,474		probably benign	Het
Gm7665	A	G	18: 16,274,731		noncoding transcript	Het
Hgf	A	C	5: 16,614,894	N541T	probably benign	Het
Hipk2	G	A	6: 38,818,879	P152S	probably benign	Het
Jarid2	C	T	13: 44,906,565	L720F	probably damaging	Het
Kifc5b	A	G	17: 26,924,787	E511G	probably damaging	Het
Ldlr	G	A	9: 21,735,242	A235T	probably benign	Het
Lmln	A	G	16: 33,074,180	D231G	possibly damaging	Het
Lrp1	A	G	10: 127,567,495	C2070R	probably damaging	Het
Mbl1	A	G	14: 41,158,724	T190A	possibly damaging	Het
Mpdz	A	T	4: 81,381,697	S355T	probably benign	Het
Muc19	C	T	15: 91,888,138		noncoding transcript	Het
Mycbp2	A	C	14: 103,139,235		probably null	Het
Naa20	T	C	2: 145,915,842	S164P	probably damaging	Het
Nme4	A	T	17: 26,093,833		probably benign	Het
Npas2	A	T	1: 39,347,506	R619*	probably null	Het
Nudt19	G	A	7: 35,555,746	T20I	possibly damaging	Het
Olfr1224-ps1	T	A	2: 89,156,939	K79*	probably null	Het
Olfr1447	A	G	19: 12,901,001	Y260H	probably damaging	Het
Pitpnc1	A	G	11: 107,296,228	Y90H	possibly damaging	Het
Rcor2	A	G	19: 7,269,785	T6A	probably benign	Het
Rif1	T	A	2: 52,109,928	S1131R	probably damaging	Het
Rtkn	T	A	6: 83,150,991	D377E	probably benign	Het
Rtn4rl2	T	A	2: 84,872,502	N242I	probably damaging	Het
Sbno2	G	A	10: 80,062,188	L719F	probably benign	Het
Scn11a	G	T	9: 119,819,831	D55E	probably damaging	Het
Setd1b	T	A	5: 123,151,866	I632N	unknown	Het
Spaca6	A	G	17: 17,831,196	T45A	probably benign	Het
Srpk2	A	T	5: 23,524,392	D416E	possibly damaging	Het
Sspo	A	T	6: 48,466,955		probably null	Het
Sycp1	A	T	3: 102,845,054	I804N	probably benign	Het
Tdp2	G	A	13: 24,831,826	R32Q	probably benign	Het
Tgfbr3	A	G	5: 107,136,929	V618A	possibly damaging	Het
Tmc3	C	T	7: 83,609,118	P439S	probably benign	Het
Tnxb	A	T	17: 34,717,483	D2740V	probably damaging	Het
Tspyl4	A	G	10: 34,297,937	T142A	probably benign	Het
Ttn	T	C	2: 76,880,441		probably benign	Het
Tubgcp4	T	C	2: 121,173,580	L34P	probably damaging	Het
Unc79	T	A	12: 103,112,703	V1690E	probably benign	Het
Vps4b	T	C	1: 106,796,418		probably null	Het
Wtap	A	G	17: 12,967,638	S341P	possibly damaging	Het
Wwc1	T	C	11: 35,883,345	T363A	probably benign	Het
Zbtb8a	G	A	4: 129,360,500	T67M	probably damaging	Het
Zfp865	T	C	7: 5,034,669		probably benign	Het

Other mutations in Tubgcp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Tubgcp6	APN	15	89104008	missense	probably benign	0.00
IGL00556:Tubgcp6	APN	15	89100962	missense	probably damaging	1.00
IGL00943:Tubgcp6	APN	15	89122397	nonsense	probably null
IGL01284:Tubgcp6	APN	15	89110055	missense	probably damaging	1.00
IGL01363:Tubgcp6	APN	15	89107525	missense	probably damaging	1.00
IGL01386:Tubgcp6	APN	15	89107996	nonsense	probably null
IGL01792:Tubgcp6	APN	15	89101281	missense	probably damaging	1.00
IGL01866:Tubgcp6	APN	15	89103488	missense	probably benign	0.01
IGL02596:Tubgcp6	APN	15	89100914	missense	probably damaging	1.00
IGL02858:Tubgcp6	APN	15	89102315	nonsense	probably null
IGL02873:Tubgcp6	APN	15	89103824	missense	probably benign	0.00
IGL03400:Tubgcp6	APN	15	89108099	unclassified	probably benign
IGL02796:Tubgcp6	UTSW	15	89122390	missense	probably benign	0.03
R0010:Tubgcp6	UTSW	15	89103183	missense	probably benign	0.00
R0308:Tubgcp6	UTSW	15	89122436	missense	possibly damaging	0.85
R0440:Tubgcp6	UTSW	15	89103065	missense	probably benign	0.12
R0631:Tubgcp6	UTSW	15	89100987	missense	probably damaging	1.00
R1653:Tubgcp6	UTSW	15	89107442	missense	probably damaging	1.00
R1901:Tubgcp6	UTSW	15	89116241	missense	possibly damaging	0.68
R1902:Tubgcp6	UTSW	15	89116241	missense	possibly damaging	0.68
R1905:Tubgcp6	UTSW	15	89100608	missense	probably damaging	1.00
R2005:Tubgcp6	UTSW	15	89104166	missense	probably benign	0.01
R2067:Tubgcp6	UTSW	15	89104489	missense	probably benign	0.03
R2083:Tubgcp6	UTSW	15	89122376	missense	probably damaging	1.00
R2285:Tubgcp6	UTSW	15	89122474	missense	probably damaging	1.00
R2401:Tubgcp6	UTSW	15	89102984	missense	probably benign	0.22
R2436:Tubgcp6	UTSW	15	89102365	missense	probably benign	0.37
R3017:Tubgcp6	UTSW	15	89103082	nonsense	probably null
R3054:Tubgcp6	UTSW	15	89122603	missense	probably damaging	1.00
R3932:Tubgcp6	UTSW	15	89104414	unclassified	probably benign
R4350:Tubgcp6	UTSW	15	89103995	missense	probably benign	0.00
R4472:Tubgcp6	UTSW	15	89103654	missense	probably damaging	0.98
R4864:Tubgcp6	UTSW	15	89103818	missense	probably benign
R4937:Tubgcp6	UTSW	15	89101549	missense	probably damaging	0.98
R4983:Tubgcp6	UTSW	15	89106291	missense	probably damaging	1.00
R4996:Tubgcp6	UTSW	15	89103490	missense	possibly damaging	0.89
R5122:Tubgcp6	UTSW	15	89116103	missense	probably damaging	1.00
R5607:Tubgcp6	UTSW	15	89111150	missense	probably benign	0.02
R5608:Tubgcp6	UTSW	15	89111150	missense	probably benign	0.02
R5653:Tubgcp6	UTSW	15	89108612	missense	possibly damaging	0.47
R5886:Tubgcp6	UTSW	15	89103247	missense	possibly damaging	0.82
R5945:Tubgcp6	UTSW	15	89109217	splice site	probably null
R6111:Tubgcp6	UTSW	15	89100920	missense	possibly damaging	0.83
R6195:Tubgcp6	UTSW	15	89122791	missense	probably benign	0.01
R6792:Tubgcp6	UTSW	15	89122877	start gained	probably benign
R7074:Tubgcp6	UTSW	15	89120636	missense	probably damaging	1.00
R7103:Tubgcp6	UTSW	15	89101029	missense	probably damaging	0.96
R7274:Tubgcp6	UTSW	15	89102970	nonsense	probably null
R7275:Tubgcp6	UTSW	15	89102943	nonsense	probably null
R7514:Tubgcp6	UTSW	15	89120525	missense	probably damaging	1.00
R7540:Tubgcp6	UTSW	15	89102323	missense	possibly damaging	0.48
R7571:Tubgcp6	UTSW	15	89100722	missense	probably damaging	1.00
R7706:Tubgcp6	UTSW	15	89104223	missense	probably benign
R7721:Tubgcp6	UTSW	15	89101401	missense	probably damaging	1.00
R7980:Tubgcp6	UTSW	15	89102029	missense	probably benign	0.03
R7996:Tubgcp6	UTSW	15	89109028	missense	possibly damaging	0.92
R8095:Tubgcp6	UTSW	15	89122774	missense	probably benign	0.07
R8191:Tubgcp6	UTSW	15	89120640	missense	probably damaging	1.00
R8510:Tubgcp6	UTSW	15	89102949	missense	possibly damaging	0.91
R8839:Tubgcp6	UTSW	15	89103478	missense	possibly damaging	0.91
R8862:Tubgcp6	UTSW	15	89122621	missense	probably benign	0.03
R9044:Tubgcp6	UTSW	15	89103194	missense	possibly damaging	0.89
R9321:Tubgcp6	UTSW	15	89107983	missense	probably damaging	1.00
R9402:Tubgcp6	UTSW	15	89102861	missense	probably benign	0.01
R9428:Tubgcp6	UTSW	15	89100897	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATCAGTCTCGGCTAGAACAG -3'
(R):5'- CAGATAGTGTGTGCTTGCCTC -3'

Sequencing Primer
(F):5'- TAGAACAGCTGAGCCCCTCTG -3'
(R):5'- GTGCTTGCCTCTGAAAAGTC -3'

Posted On

2016-06-15