Mutagenetix > Incidental Mutations

Incidental Mutation 'R5044:Muc19'

394279

Institutional Source

Beutler Lab

Gene Symbol

Muc19

Ensembl Gene

ENSMUSG00000044021

Gene Name

mucin 19

Synonyms

apomucin, sld

MMRRC Submission

042634-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.280) question?

Stock #

R5044 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91838326-91934555 bp(+) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

C to T at 91888138 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160242

SMART Domains

Protein: ENSMUSP00000125205
Gene: ENSMUSG00000044021

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	21	34	N/A	INTRINSIC
VWD	47	198	1.31e-13	SMART
Pfam:C8	221	293	1.1e-8	PFAM
Pfam:TIL	298	353	1.6e-11	PFAM
VWD	383	545	1.58e-25	SMART
C8	577	651	8.71e-20	SMART
Pfam:TIL	654	711	2.1e-7	PFAM
Pfam:TIL	753	813	5.2e-8	PFAM
VWD	842	1005	2.36e-47	SMART
C8	1041	1115	1.84e-27	SMART
low complexity region	1220	1254	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000178108

SMART Domains

Protein: ENSMUSP00000136475
Gene: ENSMUSG00000044021

Domain	Start	End	E-Value	Type
low complexity region	4	17	N/A	INTRINSIC
VWD	30	181	1.31e-13	SMART
Pfam:C8	200	277	2.5e-8	PFAM
Pfam:TIL	281	336	7.5e-12	PFAM
Pfam:VWD	377	477	4.1e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180042

SMART Domains

Protein: ENSMUSP00000136207
Gene: ENSMUSG00000044021

Domain	Start	End	E-Value	Type
C8	17	91	8.71e-20	SMART
Pfam:TIL	94	151	1.2e-7	PFAM
Pfam:TIL	193	253	6.6e-8	PFAM
VWD	282	445	2.36e-47	SMART
C8	481	555	1.84e-27	SMART
low complexity region	660	701	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

96% (73/76)

MGI Phenotype

PHENOTYPE: Mice homozygous for this spontaneous mutation show a partially arrested mucous cell differentiation of the sublingual glands. Severe inflammatory lesions resembling Sjogren's syndrome develop spontaneously in salivary and lacrimal glands of neonatally thymectomized mutants without any immunization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,373,323	F3387I	possibly damaging	Het
Acacb	T	A	5: 114,166,027	S170R	probably benign	Het
Adamtsl4	A	G	3: 95,681,650		probably null	Het
Adgrv1	A	G	13: 81,488,931	C3464R	probably benign	Het
Apbb1	A	T	7: 105,565,682		probably benign	Het
Cad	A	G	5: 31,055,021	T23A	probably benign	Het
Cdca7	A	G	2: 72,483,415	R183G	probably benign	Het
Cdpf1	T	C	15: 85,809,312	T5A	probably benign	Het
Cep85	T	C	4: 134,156,179	D133G	probably damaging	Het
Chrna9	T	C	5: 65,971,016	L189P	probably damaging	Het
Clca1	A	C	3: 145,007,928		probably null	Het
Cntn1	G	T	15: 92,242,995	V201F	probably damaging	Het
Col4a3	A	G	1: 82,666,546	E352G	unknown	Het
Ddhd2	T	C	8: 25,752,137	Y237C	probably damaging	Het
Dnah6	A	C	6: 73,037,622	F3609V	probably benign	Het
Epha3	T	C	16: 63,602,287	K580R	possibly damaging	Het
Fam135b	T	C	15: 71,462,711	N878S	probably benign	Het
Fam71e2	T	C	7: 4,758,661	N351D	probably benign	Het
Fbn1	T	G	2: 125,329,102	T1938P	probably damaging	Het
Foxg1	T	C	12: 49,385,186	V234A	probably damaging	Het
Glt1d1	A	T	5: 127,644,414	N55I	probably benign	Het
Gm17641	C	A	3: 68,869,474		probably benign	Het
Gm7665	A	G	18: 16,274,731		noncoding transcript	Het
Hgf	A	C	5: 16,614,894	N541T	probably benign	Het
Hipk2	G	A	6: 38,818,879	P152S	probably benign	Het
Jarid2	C	T	13: 44,906,565	L720F	probably damaging	Het
Kifc5b	A	G	17: 26,924,787	E511G	probably damaging	Het
Ldlr	G	A	9: 21,735,242	A235T	probably benign	Het
Lmln	A	G	16: 33,074,180	D231G	possibly damaging	Het
Lrp1	A	G	10: 127,567,495	C2070R	probably damaging	Het
Mbl1	A	G	14: 41,158,724	T190A	possibly damaging	Het
Mpdz	A	T	4: 81,381,697	S355T	probably benign	Het
Mycbp2	A	C	14: 103,139,235		probably null	Het
Naa20	T	C	2: 145,915,842	S164P	probably damaging	Het
Nme4	A	T	17: 26,093,833		probably benign	Het
Npas2	A	T	1: 39,347,506	R619*	probably null	Het
Nudt19	G	A	7: 35,555,746	T20I	possibly damaging	Het
Olfr1224-ps1	T	A	2: 89,156,939	K79*	probably null	Het
Olfr1447	A	G	19: 12,901,001	Y260H	probably damaging	Het
Pitpnc1	A	G	11: 107,296,228	Y90H	possibly damaging	Het
Rcor2	A	G	19: 7,269,785	T6A	probably benign	Het
Rif1	T	A	2: 52,109,928	S1131R	probably damaging	Het
Rtkn	T	A	6: 83,150,991	D377E	probably benign	Het
Rtn4rl2	T	A	2: 84,872,502	N242I	probably damaging	Het
Sbno2	G	A	10: 80,062,188	L719F	probably benign	Het
Scn11a	G	T	9: 119,819,831	D55E	probably damaging	Het
Setd1b	T	A	5: 123,151,866	I632N	unknown	Het
Spaca6	A	G	17: 17,831,196	T45A	probably benign	Het
Srpk2	A	T	5: 23,524,392	D416E	possibly damaging	Het
Sspo	A	T	6: 48,466,955		probably null	Het
Sycp1	A	T	3: 102,845,054	I804N	probably benign	Het
Tdp2	G	A	13: 24,831,826	R32Q	probably benign	Het
Tgfbr3	A	G	5: 107,136,929	V618A	possibly damaging	Het
Tmc3	C	T	7: 83,609,118	P439S	probably benign	Het
Tnxb	A	T	17: 34,717,483	D2740V	probably damaging	Het
Tspyl4	A	G	10: 34,297,937	T142A	probably benign	Het
Ttn	T	C	2: 76,880,441		probably benign	Het
Tubgcp4	T	C	2: 121,173,580	L34P	probably damaging	Het
Tubgcp6	G	T	15: 89,099,545		probably benign	Het
Unc79	T	A	12: 103,112,703	V1690E	probably benign	Het
Vps4b	T	C	1: 106,796,418		probably null	Het
Wtap	A	G	17: 12,967,638	S341P	possibly damaging	Het
Wwc1	T	C	11: 35,883,345	T363A	probably benign	Het
Zbtb8a	G	A	4: 129,360,500	T67M	probably damaging	Het
Zfp865	T	C	7: 5,034,669		probably benign	Het

Other mutations in Muc19

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00985:Muc19	APN	15	91886749	exon	noncoding transcript
IGL01017:Muc19	APN	15	91880707	exon	noncoding transcript
IGL01140:Muc19	APN	15	91899399	exon	noncoding transcript
IGL01292:Muc19	APN	15	91894276	exon	noncoding transcript
IGL01397:Muc19	APN	15	91894304	exon	noncoding transcript
IGL01525:Muc19	APN	15	91886683	exon	noncoding transcript
IGL01589:Muc19	APN	15	91870501	exon	noncoding transcript
IGL02023:Muc19	APN	15	91888259	exon	noncoding transcript
IGL02088:Muc19	APN	15	91891168	splice site	noncoding transcript
IGL02168:Muc19	APN	15	91894098	exon	noncoding transcript
IGL02343:Muc19	APN	15	91894234	exon	noncoding transcript
IGL02402:Muc19	APN	15	91893998	splice site	noncoding transcript
IGL02433:Muc19	APN	15	91872496	exon	noncoding transcript
IGL02533:Muc19	APN	15	91898047	exon	noncoding transcript
IGL02558:Muc19	APN	15	91897622	exon	noncoding transcript
IGL02652:Muc19	APN	15	91877815	critical splice donor site	noncoding transcript
IGL03032:Muc19	APN	15	91910539	unclassified	noncoding transcript
IGL02837:Muc19	UTSW	15	91882656	exon	noncoding transcript
R0098:Muc19	UTSW	15	91892907	exon	noncoding transcript
R0098:Muc19	UTSW	15	91892907	exon	noncoding transcript
R0208:Muc19	UTSW	15	91893024	splice site	noncoding transcript
R0597:Muc19	UTSW	15	91900502	splice site	noncoding transcript
R1185:Muc19	UTSW	15	91878549	exon	noncoding transcript
R1185:Muc19	UTSW	15	91878549	exon	noncoding transcript
R1469:Muc19	UTSW	15	91874300	unclassified	noncoding transcript
R1942:Muc19	UTSW	15	91892472	exon	noncoding transcript
R2035:Muc19	UTSW	15	91892405	splice site	noncoding transcript
R2208:Muc19	UTSW	15	91871549	exon	noncoding transcript
R2877:Muc19	UTSW	15	91893006	exon	noncoding transcript
R2897:Muc19	UTSW	15	91924665	critical splice donor site	noncoding transcript
R4110:Muc19	UTSW	15	91897622	exon	noncoding transcript
R4403:Muc19	UTSW	15	91871570	exon	noncoding transcript
R4606:Muc19	UTSW	15	91934383	exon	noncoding transcript
R4677:Muc19	UTSW	15	91888217	exon	noncoding transcript
R4753:Muc19	UTSW	15	91877761	unclassified	noncoding transcript
R4781:Muc19	UTSW	15	91903166	critical splice donor site	noncoding transcript
R4869:Muc19	UTSW	15	91897716	exon	noncoding transcript
R5000:Muc19	UTSW	15	91873231	unclassified	noncoding transcript
R5156:Muc19	UTSW	15	91900420	exon	noncoding transcript
R5176:Muc19	UTSW	15	91892180	exon	noncoding transcript
R5224:Muc19	UTSW	15	91928025	exon	noncoding transcript
R5524:Muc19	UTSW	15	91894393	exon	noncoding transcript
R5568:Muc19	UTSW	15	91884274	splice site	noncoding transcript
R5592:Muc19	UTSW	15	91930314	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- CTAGCCCACTTGTGGCTTTG -3'
(R):5'- TTGCCAGGTTGCACGATCTC -3'

Sequencing Primer
(F):5'- TGTTCTAAGCACCAACTGAAAAG -3'
(R):5'- CAGGTTGCACGATCTCATCATTAAC -3'

Posted On

2016-06-15