Incidental Mutation 'R5044:Muc19'
ID 394279
Institutional Source Beutler Lab
Gene Symbol Muc19
Ensembl Gene ENSMUSG00000044021
Gene Name mucin 19
Synonyms apomucin, sld
MMRRC Submission 042634-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock # R5044 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 91838326-91934555 bp(+) (GRCm38)
Type of Mutation exon
DNA Base Change (assembly) C to T at 91888138 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160242
SMART Domains Protein: ENSMUSP00000125205
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 21 34 N/A INTRINSIC
VWD 47 198 1.31e-13 SMART
Pfam:C8 221 293 1.1e-8 PFAM
Pfam:TIL 298 353 1.6e-11 PFAM
VWD 383 545 1.58e-25 SMART
C8 577 651 8.71e-20 SMART
Pfam:TIL 654 711 2.1e-7 PFAM
Pfam:TIL 753 813 5.2e-8 PFAM
VWD 842 1005 2.36e-47 SMART
C8 1041 1115 1.84e-27 SMART
low complexity region 1220 1254 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178108
SMART Domains Protein: ENSMUSP00000136475
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
VWD 30 181 1.31e-13 SMART
Pfam:C8 200 277 2.5e-8 PFAM
Pfam:TIL 281 336 7.5e-12 PFAM
Pfam:VWD 377 477 4.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180042
SMART Domains Protein: ENSMUSP00000136207
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
C8 17 91 8.71e-20 SMART
Pfam:TIL 94 151 1.2e-7 PFAM
Pfam:TIL 193 253 6.6e-8 PFAM
VWD 282 445 2.36e-47 SMART
C8 481 555 1.84e-27 SMART
low complexity region 660 701 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (73/76)
MGI Phenotype PHENOTYPE: Mice homozygous for this spontaneous mutation show a partially arrested mucous cell differentiation of the sublingual glands. Severe inflammatory lesions resembling Sjogren's syndrome develop spontaneously in salivary and lacrimal glands of neonatally thymectomized mutants without any immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,323 F3387I possibly damaging Het
Acacb T A 5: 114,166,027 S170R probably benign Het
Adamtsl4 A G 3: 95,681,650 probably null Het
Adgrv1 A G 13: 81,488,931 C3464R probably benign Het
Apbb1 A T 7: 105,565,682 probably benign Het
Cad A G 5: 31,055,021 T23A probably benign Het
Cdca7 A G 2: 72,483,415 R183G probably benign Het
Cdpf1 T C 15: 85,809,312 T5A probably benign Het
Cep85 T C 4: 134,156,179 D133G probably damaging Het
Chrna9 T C 5: 65,971,016 L189P probably damaging Het
Clca1 A C 3: 145,007,928 probably null Het
Cntn1 G T 15: 92,242,995 V201F probably damaging Het
Col4a3 A G 1: 82,666,546 E352G unknown Het
Ddhd2 T C 8: 25,752,137 Y237C probably damaging Het
Dnah6 A C 6: 73,037,622 F3609V probably benign Het
Epha3 T C 16: 63,602,287 K580R possibly damaging Het
Fam135b T C 15: 71,462,711 N878S probably benign Het
Fam71e2 T C 7: 4,758,661 N351D probably benign Het
Fbn1 T G 2: 125,329,102 T1938P probably damaging Het
Foxg1 T C 12: 49,385,186 V234A probably damaging Het
Glt1d1 A T 5: 127,644,414 N55I probably benign Het
Gm17641 C A 3: 68,869,474 probably benign Het
Gm7665 A G 18: 16,274,731 noncoding transcript Het
Hgf A C 5: 16,614,894 N541T probably benign Het
Hipk2 G A 6: 38,818,879 P152S probably benign Het
Jarid2 C T 13: 44,906,565 L720F probably damaging Het
Kifc5b A G 17: 26,924,787 E511G probably damaging Het
Ldlr G A 9: 21,735,242 A235T probably benign Het
Lmln A G 16: 33,074,180 D231G possibly damaging Het
Lrp1 A G 10: 127,567,495 C2070R probably damaging Het
Mbl1 A G 14: 41,158,724 T190A possibly damaging Het
Mpdz A T 4: 81,381,697 S355T probably benign Het
Mycbp2 A C 14: 103,139,235 probably null Het
Naa20 T C 2: 145,915,842 S164P probably damaging Het
Nme4 A T 17: 26,093,833 probably benign Het
Npas2 A T 1: 39,347,506 R619* probably null Het
Nudt19 G A 7: 35,555,746 T20I possibly damaging Het
Olfr1224-ps1 T A 2: 89,156,939 K79* probably null Het
Olfr1447 A G 19: 12,901,001 Y260H probably damaging Het
Pitpnc1 A G 11: 107,296,228 Y90H possibly damaging Het
Rcor2 A G 19: 7,269,785 T6A probably benign Het
Rif1 T A 2: 52,109,928 S1131R probably damaging Het
Rtkn T A 6: 83,150,991 D377E probably benign Het
Rtn4rl2 T A 2: 84,872,502 N242I probably damaging Het
Sbno2 G A 10: 80,062,188 L719F probably benign Het
Scn11a G T 9: 119,819,831 D55E probably damaging Het
Setd1b T A 5: 123,151,866 I632N unknown Het
Spaca6 A G 17: 17,831,196 T45A probably benign Het
Srpk2 A T 5: 23,524,392 D416E possibly damaging Het
Sspo A T 6: 48,466,955 probably null Het
Sycp1 A T 3: 102,845,054 I804N probably benign Het
Tdp2 G A 13: 24,831,826 R32Q probably benign Het
Tgfbr3 A G 5: 107,136,929 V618A possibly damaging Het
Tmc3 C T 7: 83,609,118 P439S probably benign Het
Tnxb A T 17: 34,717,483 D2740V probably damaging Het
Tspyl4 A G 10: 34,297,937 T142A probably benign Het
Ttn T C 2: 76,880,441 probably benign Het
Tubgcp4 T C 2: 121,173,580 L34P probably damaging Het
Tubgcp6 G T 15: 89,099,545 probably benign Het
Unc79 T A 12: 103,112,703 V1690E probably benign Het
Vps4b T C 1: 106,796,418 probably null Het
Wtap A G 17: 12,967,638 S341P possibly damaging Het
Wwc1 T C 11: 35,883,345 T363A probably benign Het
Zbtb8a G A 4: 129,360,500 T67M probably damaging Het
Zfp865 T C 7: 5,034,669 probably benign Het
Other mutations in Muc19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Muc19 APN 15 91886749 exon noncoding transcript
IGL01017:Muc19 APN 15 91880707 exon noncoding transcript
IGL01140:Muc19 APN 15 91899399 exon noncoding transcript
IGL01292:Muc19 APN 15 91894276 exon noncoding transcript
IGL01397:Muc19 APN 15 91894304 exon noncoding transcript
IGL01525:Muc19 APN 15 91886683 exon noncoding transcript
IGL01589:Muc19 APN 15 91870501 exon noncoding transcript
IGL02023:Muc19 APN 15 91888259 exon noncoding transcript
IGL02088:Muc19 APN 15 91891168 splice site noncoding transcript
IGL02168:Muc19 APN 15 91894098 exon noncoding transcript
IGL02343:Muc19 APN 15 91894234 exon noncoding transcript
IGL02402:Muc19 APN 15 91893998 splice site noncoding transcript
IGL02433:Muc19 APN 15 91872496 exon noncoding transcript
IGL02533:Muc19 APN 15 91898047 exon noncoding transcript
IGL02558:Muc19 APN 15 91897622 exon noncoding transcript
IGL02652:Muc19 APN 15 91877815 critical splice donor site noncoding transcript
IGL03032:Muc19 APN 15 91910539 unclassified noncoding transcript
IGL02837:Muc19 UTSW 15 91882656 exon noncoding transcript
R0098:Muc19 UTSW 15 91892907 exon noncoding transcript
R0098:Muc19 UTSW 15 91892907 exon noncoding transcript
R0208:Muc19 UTSW 15 91893024 splice site noncoding transcript
R0597:Muc19 UTSW 15 91900502 splice site noncoding transcript
R1185:Muc19 UTSW 15 91878549 exon noncoding transcript
R1185:Muc19 UTSW 15 91878549 exon noncoding transcript
R1469:Muc19 UTSW 15 91874300 unclassified noncoding transcript
R1942:Muc19 UTSW 15 91892472 exon noncoding transcript
R2035:Muc19 UTSW 15 91892405 splice site noncoding transcript
R2208:Muc19 UTSW 15 91871549 exon noncoding transcript
R2877:Muc19 UTSW 15 91893006 exon noncoding transcript
R2897:Muc19 UTSW 15 91924665 critical splice donor site noncoding transcript
R4110:Muc19 UTSW 15 91897622 exon noncoding transcript
R4403:Muc19 UTSW 15 91871570 exon noncoding transcript
R4606:Muc19 UTSW 15 91934383 exon noncoding transcript
R4677:Muc19 UTSW 15 91888217 exon noncoding transcript
R4753:Muc19 UTSW 15 91877761 unclassified noncoding transcript
R4781:Muc19 UTSW 15 91903166 critical splice donor site noncoding transcript
R4869:Muc19 UTSW 15 91897716 exon noncoding transcript
R5000:Muc19 UTSW 15 91873231 unclassified noncoding transcript
R5156:Muc19 UTSW 15 91900420 exon noncoding transcript
R5176:Muc19 UTSW 15 91892180 exon noncoding transcript
R5224:Muc19 UTSW 15 91928025 exon noncoding transcript
R5524:Muc19 UTSW 15 91894393 exon noncoding transcript
R5568:Muc19 UTSW 15 91884274 splice site noncoding transcript
R5592:Muc19 UTSW 15 91930314 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CTAGCCCACTTGTGGCTTTG -3'
(R):5'- TTGCCAGGTTGCACGATCTC -3'

Sequencing Primer
(F):5'- TGTTCTAAGCACCAACTGAAAAG -3'
(R):5'- CAGGTTGCACGATCTCATCATTAAC -3'
Posted On 2016-06-15