Incidental Mutation 'R5044:Cntn1'
ID 394280
Institutional Source Beutler Lab
Gene Symbol Cntn1
Ensembl Gene ENSMUSG00000055022
Gene Name contactin 1
Synonyms CNTN, F3cam
MMRRC Submission 042634-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5044 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 92051165-92341967 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 92242995 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 201 (V201F)
Ref Sequence ENSEMBL: ENSMUSP00000133063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000109] [ENSMUST00000068378] [ENSMUST00000169825]
AlphaFold P12960
Predicted Effect probably damaging
Transcript: ENSMUST00000000109
AA Change: V201F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000109
Gene: ENSMUSG00000055022
AA Change: V201F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068378
AA Change: V201F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067842
Gene: ENSMUSG00000055022
AA Change: V201F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141187
Predicted Effect probably damaging
Transcript: ENSMUST00000169825
AA Change: V201F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133063
Gene: ENSMUSG00000055022
AA Change: V201F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Meta Mutation Damage Score 0.7766 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mutations of this gene result in growth retardation, progressive ataxia and death prior to weaning. A targeted null mutation, but not a spontaneous mutation, causes a small cerebellum with abnormalities of the molecular layer and abnormal Purkinje cellaxon morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,323 F3387I possibly damaging Het
Acacb T A 5: 114,166,027 S170R probably benign Het
Adamtsl4 A G 3: 95,681,650 probably null Het
Adgrv1 A G 13: 81,488,931 C3464R probably benign Het
Apbb1 A T 7: 105,565,682 probably benign Het
Cad A G 5: 31,055,021 T23A probably benign Het
Cdca7 A G 2: 72,483,415 R183G probably benign Het
Cdpf1 T C 15: 85,809,312 T5A probably benign Het
Cep85 T C 4: 134,156,179 D133G probably damaging Het
Chrna9 T C 5: 65,971,016 L189P probably damaging Het
Clca1 A C 3: 145,007,928 probably null Het
Col4a3 A G 1: 82,666,546 E352G unknown Het
Ddhd2 T C 8: 25,752,137 Y237C probably damaging Het
Dnah6 A C 6: 73,037,622 F3609V probably benign Het
Epha3 T C 16: 63,602,287 K580R possibly damaging Het
Fam135b T C 15: 71,462,711 N878S probably benign Het
Fam71e2 T C 7: 4,758,661 N351D probably benign Het
Fbn1 T G 2: 125,329,102 T1938P probably damaging Het
Foxg1 T C 12: 49,385,186 V234A probably damaging Het
Glt1d1 A T 5: 127,644,414 N55I probably benign Het
Gm17641 C A 3: 68,869,474 probably benign Het
Gm7665 A G 18: 16,274,731 noncoding transcript Het
Hgf A C 5: 16,614,894 N541T probably benign Het
Hipk2 G A 6: 38,818,879 P152S probably benign Het
Jarid2 C T 13: 44,906,565 L720F probably damaging Het
Kifc5b A G 17: 26,924,787 E511G probably damaging Het
Ldlr G A 9: 21,735,242 A235T probably benign Het
Lmln A G 16: 33,074,180 D231G possibly damaging Het
Lrp1 A G 10: 127,567,495 C2070R probably damaging Het
Mbl1 A G 14: 41,158,724 T190A possibly damaging Het
Mpdz A T 4: 81,381,697 S355T probably benign Het
Muc19 C T 15: 91,888,138 noncoding transcript Het
Mycbp2 A C 14: 103,139,235 probably null Het
Naa20 T C 2: 145,915,842 S164P probably damaging Het
Nme4 A T 17: 26,093,833 probably benign Het
Npas2 A T 1: 39,347,506 R619* probably null Het
Nudt19 G A 7: 35,555,746 T20I possibly damaging Het
Olfr1224-ps1 T A 2: 89,156,939 K79* probably null Het
Olfr1447 A G 19: 12,901,001 Y260H probably damaging Het
Pitpnc1 A G 11: 107,296,228 Y90H possibly damaging Het
Rcor2 A G 19: 7,269,785 T6A probably benign Het
Rif1 T A 2: 52,109,928 S1131R probably damaging Het
Rtkn T A 6: 83,150,991 D377E probably benign Het
Rtn4rl2 T A 2: 84,872,502 N242I probably damaging Het
Sbno2 G A 10: 80,062,188 L719F probably benign Het
Scn11a G T 9: 119,819,831 D55E probably damaging Het
Setd1b T A 5: 123,151,866 I632N unknown Het
Spaca6 A G 17: 17,831,196 T45A probably benign Het
Srpk2 A T 5: 23,524,392 D416E possibly damaging Het
Sspo A T 6: 48,466,955 probably null Het
Sycp1 A T 3: 102,845,054 I804N probably benign Het
Tdp2 G A 13: 24,831,826 R32Q probably benign Het
Tgfbr3 A G 5: 107,136,929 V618A possibly damaging Het
Tmc3 C T 7: 83,609,118 P439S probably benign Het
Tnxb A T 17: 34,717,483 D2740V probably damaging Het
Tspyl4 A G 10: 34,297,937 T142A probably benign Het
Ttn T C 2: 76,880,441 probably benign Het
Tubgcp4 T C 2: 121,173,580 L34P probably damaging Het
Tubgcp6 G T 15: 89,099,545 probably benign Het
Unc79 T A 12: 103,112,703 V1690E probably benign Het
Vps4b T C 1: 106,796,418 probably null Het
Wtap A G 17: 12,967,638 S341P possibly damaging Het
Wwc1 T C 11: 35,883,345 T363A probably benign Het
Zbtb8a G A 4: 129,360,500 T67M probably damaging Het
Zfp865 T C 7: 5,034,669 probably benign Het
Other mutations in Cntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Cntn1 APN 15 92250877 missense possibly damaging 0.92
IGL01109:Cntn1 APN 15 92339577 nonsense probably null
IGL01399:Cntn1 APN 15 92305144 missense probably damaging 1.00
IGL01714:Cntn1 APN 15 92253989 nonsense probably null
IGL02052:Cntn1 APN 15 92291703 missense possibly damaging 0.95
IGL02342:Cntn1 APN 15 92246017 missense probably benign 0.01
IGL02507:Cntn1 APN 15 92250979 missense possibly damaging 0.92
IGL02511:Cntn1 APN 15 92216385 start gained probably benign
IGL02702:Cntn1 APN 15 92291601 splice site probably benign
IGL02927:Cntn1 APN 15 92291680 missense probably benign 0.12
IGL02948:Cntn1 APN 15 92246010 missense probably benign 0.01
R0035:Cntn1 UTSW 15 92232088 splice site probably benign
R0084:Cntn1 UTSW 15 92317917 missense probably benign 0.01
R0346:Cntn1 UTSW 15 92232087 splice site probably benign
R0634:Cntn1 UTSW 15 92314563 nonsense probably null
R1348:Cntn1 UTSW 15 92314663 missense probably damaging 1.00
R1613:Cntn1 UTSW 15 92245990 missense possibly damaging 0.60
R1793:Cntn1 UTSW 15 92291671 missense possibly damaging 0.92
R1815:Cntn1 UTSW 15 92250948 missense probably benign 0.00
R1851:Cntn1 UTSW 15 92305140 missense probably damaging 1.00
R1852:Cntn1 UTSW 15 92305140 missense probably damaging 1.00
R2068:Cntn1 UTSW 15 92318062 missense possibly damaging 0.82
R2269:Cntn1 UTSW 15 92294982 splice site probably benign
R4394:Cntn1 UTSW 15 92291764 missense probably damaging 1.00
R4667:Cntn1 UTSW 15 92295079 missense probably damaging 1.00
R4771:Cntn1 UTSW 15 92305091 missense possibly damaging 0.82
R4944:Cntn1 UTSW 15 92228668 missense probably damaging 1.00
R5218:Cntn1 UTSW 15 92339549 missense unknown
R5314:Cntn1 UTSW 15 92295011 missense probably benign 0.01
R5445:Cntn1 UTSW 15 92295077 missense probably damaging 1.00
R5518:Cntn1 UTSW 15 92314653 missense probably benign 0.00
R6849:Cntn1 UTSW 15 92305246 missense probably damaging 0.99
R6885:Cntn1 UTSW 15 92243099 critical splice donor site probably null
R7035:Cntn1 UTSW 15 92314511 missense probably benign 0.04
R7070:Cntn1 UTSW 15 92254036 missense probably damaging 1.00
R7287:Cntn1 UTSW 15 92245952 splice site probably null
R7311:Cntn1 UTSW 15 92232275 critical splice donor site probably null
R7401:Cntn1 UTSW 15 92317989 missense probably benign
R7484:Cntn1 UTSW 15 92254041 missense probably benign 0.00
R7492:Cntn1 UTSW 15 92314542 missense probably benign
R7617:Cntn1 UTSW 15 92246089 missense probably damaging 1.00
R7644:Cntn1 UTSW 15 92310009 missense probably benign 0.14
R7878:Cntn1 UTSW 15 92295053 missense probably damaging 1.00
R8354:Cntn1 UTSW 15 92232249 missense probably benign
R8454:Cntn1 UTSW 15 92232249 missense probably benign
R8465:Cntn1 UTSW 15 92339523 frame shift probably null
R8757:Cntn1 UTSW 15 92255920 missense possibly damaging 0.90
R8759:Cntn1 UTSW 15 92255920 missense possibly damaging 0.90
R8767:Cntn1 UTSW 15 92234466 missense probably damaging 1.00
R8768:Cntn1 UTSW 15 92234466 missense probably damaging 1.00
R8885:Cntn1 UTSW 15 92261499 missense probably benign 0.00
R8972:Cntn1 UTSW 15 92252397 missense probably benign 0.18
R8993:Cntn1 UTSW 15 92234466 missense probably damaging 1.00
R8995:Cntn1 UTSW 15 92234466 missense probably damaging 1.00
R8997:Cntn1 UTSW 15 92234466 missense probably damaging 1.00
R9151:Cntn1 UTSW 15 92242983 missense probably damaging 1.00
R9438:Cntn1 UTSW 15 92246143 critical splice donor site probably null
Z1177:Cntn1 UTSW 15 92309970 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGAGTAGGAATCAGAACCTTC -3'
(R):5'- TCCAACGATTAAGACTTATGCAGC -3'

Sequencing Primer
(F):5'- GGAATCAGAACCTTCTCTTACTGAG -3'
(R):5'- ATACACTATATGCTGTCTGGCAC -3'
Posted On 2016-06-15