Mutagenetix > Incidental Mutations

Incidental Mutation 'R5044:Cntn1'

394280

Institutional Source

Beutler Lab

Gene Symbol

Cntn1

Ensembl Gene

ENSMUSG00000055022

Gene Name

contactin 1

Synonyms

CNTN, F3cam

MMRRC Submission

042634-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5044 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92051165-92341967 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 92242995 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 201 (V201F)

Ref Sequence

ENSEMBL: ENSMUSP00000133063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000109] [ENSMUST00000068378] [ENSMUST00000169825]

AlphaFold

P12960

Predicted Effect

probably damaging
Transcript: ENSMUST00000000109
AA Change: V201F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000000109
Gene: ENSMUSG00000055022
AA Change: V201F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IGc2	56	121	4.07e-4	SMART
IG	143	232	1.25e-4	SMART
IGc2	254	317	1.24e-17	SMART
IGc2	343	398	4.22e-11	SMART
IGc2	427	491	2.52e-9	SMART
IG	511	603	3.51e-8	SMART
FN3	606	692	6.69e-12	SMART
FN3	709	795	1.17e-2	SMART
FN3	811	892	1.16e-6	SMART
FN3	907	987	2.46e-1	SMART
low complexity region	995	1018	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000068378
AA Change: V201F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067842
Gene: ENSMUSG00000055022
AA Change: V201F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IGc2	56	121	4.07e-4	SMART
IG	143	232	1.25e-4	SMART
IGc2	254	317	1.24e-17	SMART
IGc2	343	398	4.22e-11	SMART
IGc2	427	491	2.52e-9	SMART
IG	511	603	3.51e-8	SMART
FN3	606	692	6.69e-12	SMART
FN3	709	795	1.17e-2	SMART
FN3	811	892	1.16e-6	SMART
FN3	907	987	2.46e-1	SMART
low complexity region	995	1018	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141187

Predicted Effect

probably damaging
Transcript: ENSMUST00000169825
AA Change: V201F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133063
Gene: ENSMUSG00000055022
AA Change: V201F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IGc2	56	121	4.07e-4	SMART
IG	143	232	1.25e-4	SMART
IGc2	254	317	1.24e-17	SMART
IGc2	343	398	4.22e-11	SMART
IGc2	427	491	2.52e-9	SMART
IG	511	603	3.51e-8	SMART
FN3	606	692	6.69e-12	SMART
FN3	709	795	1.17e-2	SMART
FN3	811	892	1.16e-6	SMART
FN3	907	987	2.46e-1	SMART
low complexity region	995	1018	N/A	INTRINSIC

Meta Mutation Damage Score

0.7766

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

96% (73/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mutations of this gene result in growth retardation, progressive ataxia and death prior to weaning. A targeted null mutation, but not a spontaneous mutation, causes a small cerebellum with abnormalities of the molecular layer and abnormal Purkinje cellaxon morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,373,323	F3387I	possibly damaging	Het
Acacb	T	A	5: 114,166,027	S170R	probably benign	Het
Adamtsl4	A	G	3: 95,681,650		probably null	Het
Adgrv1	A	G	13: 81,488,931	C3464R	probably benign	Het
Apbb1	A	T	7: 105,565,682		probably benign	Het
Cad	A	G	5: 31,055,021	T23A	probably benign	Het
Cdca7	A	G	2: 72,483,415	R183G	probably benign	Het
Cdpf1	T	C	15: 85,809,312	T5A	probably benign	Het
Cep85	T	C	4: 134,156,179	D133G	probably damaging	Het
Chrna9	T	C	5: 65,971,016	L189P	probably damaging	Het
Clca1	A	C	3: 145,007,928		probably null	Het
Col4a3	A	G	1: 82,666,546	E352G	unknown	Het
Ddhd2	T	C	8: 25,752,137	Y237C	probably damaging	Het
Dnah6	A	C	6: 73,037,622	F3609V	probably benign	Het
Epha3	T	C	16: 63,602,287	K580R	possibly damaging	Het
Fam135b	T	C	15: 71,462,711	N878S	probably benign	Het
Fam71e2	T	C	7: 4,758,661	N351D	probably benign	Het
Fbn1	T	G	2: 125,329,102	T1938P	probably damaging	Het
Foxg1	T	C	12: 49,385,186	V234A	probably damaging	Het
Glt1d1	A	T	5: 127,644,414	N55I	probably benign	Het
Gm17641	C	A	3: 68,869,474		probably benign	Het
Gm7665	A	G	18: 16,274,731		noncoding transcript	Het
Hgf	A	C	5: 16,614,894	N541T	probably benign	Het
Hipk2	G	A	6: 38,818,879	P152S	probably benign	Het
Jarid2	C	T	13: 44,906,565	L720F	probably damaging	Het
Kifc5b	A	G	17: 26,924,787	E511G	probably damaging	Het
Ldlr	G	A	9: 21,735,242	A235T	probably benign	Het
Lmln	A	G	16: 33,074,180	D231G	possibly damaging	Het
Lrp1	A	G	10: 127,567,495	C2070R	probably damaging	Het
Mbl1	A	G	14: 41,158,724	T190A	possibly damaging	Het
Mpdz	A	T	4: 81,381,697	S355T	probably benign	Het
Muc19	C	T	15: 91,888,138		noncoding transcript	Het
Mycbp2	A	C	14: 103,139,235		probably null	Het
Naa20	T	C	2: 145,915,842	S164P	probably damaging	Het
Nme4	A	T	17: 26,093,833		probably benign	Het
Npas2	A	T	1: 39,347,506	R619*	probably null	Het
Nudt19	G	A	7: 35,555,746	T20I	possibly damaging	Het
Olfr1224-ps1	T	A	2: 89,156,939	K79*	probably null	Het
Olfr1447	A	G	19: 12,901,001	Y260H	probably damaging	Het
Pitpnc1	A	G	11: 107,296,228	Y90H	possibly damaging	Het
Rcor2	A	G	19: 7,269,785	T6A	probably benign	Het
Rif1	T	A	2: 52,109,928	S1131R	probably damaging	Het
Rtkn	T	A	6: 83,150,991	D377E	probably benign	Het
Rtn4rl2	T	A	2: 84,872,502	N242I	probably damaging	Het
Sbno2	G	A	10: 80,062,188	L719F	probably benign	Het
Scn11a	G	T	9: 119,819,831	D55E	probably damaging	Het
Setd1b	T	A	5: 123,151,866	I632N	unknown	Het
Spaca6	A	G	17: 17,831,196	T45A	probably benign	Het
Srpk2	A	T	5: 23,524,392	D416E	possibly damaging	Het
Sspo	A	T	6: 48,466,955		probably null	Het
Sycp1	A	T	3: 102,845,054	I804N	probably benign	Het
Tdp2	G	A	13: 24,831,826	R32Q	probably benign	Het
Tgfbr3	A	G	5: 107,136,929	V618A	possibly damaging	Het
Tmc3	C	T	7: 83,609,118	P439S	probably benign	Het
Tnxb	A	T	17: 34,717,483	D2740V	probably damaging	Het
Tspyl4	A	G	10: 34,297,937	T142A	probably benign	Het
Ttn	T	C	2: 76,880,441		probably benign	Het
Tubgcp4	T	C	2: 121,173,580	L34P	probably damaging	Het
Tubgcp6	G	T	15: 89,099,545		probably benign	Het
Unc79	T	A	12: 103,112,703	V1690E	probably benign	Het
Vps4b	T	C	1: 106,796,418		probably null	Het
Wtap	A	G	17: 12,967,638	S341P	possibly damaging	Het
Wwc1	T	C	11: 35,883,345	T363A	probably benign	Het
Zbtb8a	G	A	4: 129,360,500	T67M	probably damaging	Het
Zfp865	T	C	7: 5,034,669		probably benign	Het

Other mutations in Cntn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Cntn1	APN	15	92250877	missense	possibly damaging	0.92
IGL01109:Cntn1	APN	15	92339577	nonsense	probably null
IGL01399:Cntn1	APN	15	92305144	missense	probably damaging	1.00
IGL01714:Cntn1	APN	15	92253989	nonsense	probably null
IGL02052:Cntn1	APN	15	92291703	missense	possibly damaging	0.95
IGL02342:Cntn1	APN	15	92246017	missense	probably benign	0.01
IGL02507:Cntn1	APN	15	92250979	missense	possibly damaging	0.92
IGL02511:Cntn1	APN	15	92216385	start gained	probably benign
IGL02702:Cntn1	APN	15	92291601	splice site	probably benign
IGL02927:Cntn1	APN	15	92291680	missense	probably benign	0.12
IGL02948:Cntn1	APN	15	92246010	missense	probably benign	0.01
R0035:Cntn1	UTSW	15	92232088	splice site	probably benign
R0084:Cntn1	UTSW	15	92317917	missense	probably benign	0.01
R0346:Cntn1	UTSW	15	92232087	splice site	probably benign
R0634:Cntn1	UTSW	15	92314563	nonsense	probably null
R1348:Cntn1	UTSW	15	92314663	missense	probably damaging	1.00
R1613:Cntn1	UTSW	15	92245990	missense	possibly damaging	0.60
R1793:Cntn1	UTSW	15	92291671	missense	possibly damaging	0.92
R1815:Cntn1	UTSW	15	92250948	missense	probably benign	0.00
R1851:Cntn1	UTSW	15	92305140	missense	probably damaging	1.00
R1852:Cntn1	UTSW	15	92305140	missense	probably damaging	1.00
R2068:Cntn1	UTSW	15	92318062	missense	possibly damaging	0.82
R2269:Cntn1	UTSW	15	92294982	splice site	probably benign
R4394:Cntn1	UTSW	15	92291764	missense	probably damaging	1.00
R4667:Cntn1	UTSW	15	92295079	missense	probably damaging	1.00
R4771:Cntn1	UTSW	15	92305091	missense	possibly damaging	0.82
R4944:Cntn1	UTSW	15	92228668	missense	probably damaging	1.00
R5218:Cntn1	UTSW	15	92339549	missense	unknown
R5314:Cntn1	UTSW	15	92295011	missense	probably benign	0.01
R5445:Cntn1	UTSW	15	92295077	missense	probably damaging	1.00
R5518:Cntn1	UTSW	15	92314653	missense	probably benign	0.00
R6849:Cntn1	UTSW	15	92305246	missense	probably damaging	0.99
R6885:Cntn1	UTSW	15	92243099	critical splice donor site	probably null
R7035:Cntn1	UTSW	15	92314511	missense	probably benign	0.04
R7070:Cntn1	UTSW	15	92254036	missense	probably damaging	1.00
R7287:Cntn1	UTSW	15	92245952	splice site	probably null
R7311:Cntn1	UTSW	15	92232275	critical splice donor site	probably null
R7401:Cntn1	UTSW	15	92317989	missense	probably benign
R7484:Cntn1	UTSW	15	92254041	missense	probably benign	0.00
R7492:Cntn1	UTSW	15	92314542	missense	probably benign
R7617:Cntn1	UTSW	15	92246089	missense	probably damaging	1.00
R7644:Cntn1	UTSW	15	92310009	missense	probably benign	0.14
R7878:Cntn1	UTSW	15	92295053	missense	probably damaging	1.00
R8354:Cntn1	UTSW	15	92232249	missense	probably benign
R8454:Cntn1	UTSW	15	92232249	missense	probably benign
R8465:Cntn1	UTSW	15	92339523	frame shift	probably null
R8757:Cntn1	UTSW	15	92255920	missense	possibly damaging	0.90
R8759:Cntn1	UTSW	15	92255920	missense	possibly damaging	0.90
R8767:Cntn1	UTSW	15	92234466	missense	probably damaging	1.00
R8768:Cntn1	UTSW	15	92234466	missense	probably damaging	1.00
R8885:Cntn1	UTSW	15	92261499	missense	probably benign	0.00
R8972:Cntn1	UTSW	15	92252397	missense	probably benign	0.18
R8993:Cntn1	UTSW	15	92234466	missense	probably damaging	1.00
R8995:Cntn1	UTSW	15	92234466	missense	probably damaging	1.00
R8997:Cntn1	UTSW	15	92234466	missense	probably damaging	1.00
R9151:Cntn1	UTSW	15	92242983	missense	probably damaging	1.00
R9438:Cntn1	UTSW	15	92246143	critical splice donor site	probably null
Z1177:Cntn1	UTSW	15	92309970	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCGAGTAGGAATCAGAACCTTC -3'
(R):5'- TCCAACGATTAAGACTTATGCAGC -3'

Sequencing Primer
(F):5'- GGAATCAGAACCTTCTCTTACTGAG -3'
(R):5'- ATACACTATATGCTGTCTGGCAC -3'

Posted On

2016-06-15