Incidental Mutation 'R5044:Spaca6'
ID394284
Institutional Source Beutler Lab
Gene Symbol Spaca6
Ensembl Gene ENSMUSG00000080316
Gene Namesperm acrosome associated 6
SynonymsB230206P06Rik, 4930546H06Rik, Ncrna00085
MMRRC Submission 042634-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5044 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location17827158-17843009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17831196 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 45 (T45A)
Ref Sequence ENSEMBL: ENSMUSP00000119658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000139969] [ENSMUST00000150302] [ENSMUST00000172097] [ENSMUST00000226899] [ENSMUST00000228490]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000012759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137228
Predicted Effect probably benign
Transcript: ENSMUST00000139969
AA Change: T45A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119658
Gene: ENSMUSG00000080316
AA Change: T45A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG 151 186 1e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155293
Predicted Effect probably benign
Transcript: ENSMUST00000172097
AA Change: T65A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128732
Gene: ENSMUSG00000080316
AA Change: T65A

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IG 171 260 2.08e-1 SMART
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196737
Predicted Effect probably benign
Transcript: ENSMUST00000226899
Predicted Effect probably benign
Transcript: ENSMUST00000228490
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (73/76)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion that inactivates this gene exhibit impaired fertilization and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,323 F3387I possibly damaging Het
Acacb T A 5: 114,166,027 S170R probably benign Het
Adamtsl4 A G 3: 95,681,650 probably null Het
Adgrv1 A G 13: 81,488,931 C3464R probably benign Het
Apbb1 A T 7: 105,565,682 probably benign Het
Cad A G 5: 31,055,021 T23A probably benign Het
Cdca7 A G 2: 72,483,415 R183G probably benign Het
Cdpf1 T C 15: 85,809,312 T5A probably benign Het
Cep85 T C 4: 134,156,179 D133G probably damaging Het
Chrna9 T C 5: 65,971,016 L189P probably damaging Het
Clca1 A C 3: 145,007,928 probably null Het
Cntn1 G T 15: 92,242,995 V201F probably damaging Het
Col4a3 A G 1: 82,666,546 E352G unknown Het
Ddhd2 T C 8: 25,752,137 Y237C probably damaging Het
Dnah6 A C 6: 73,037,622 F3609V probably benign Het
Epha3 T C 16: 63,602,287 K580R possibly damaging Het
Fam135b T C 15: 71,462,711 N878S probably benign Het
Fam71e2 T C 7: 4,758,661 N351D probably benign Het
Fbn1 T G 2: 125,329,102 T1938P probably damaging Het
Foxg1 T C 12: 49,385,186 V234A probably damaging Het
Glt1d1 A T 5: 127,644,414 N55I probably benign Het
Gm17641 C A 3: 68,869,474 probably benign Het
Gm7665 A G 18: 16,274,731 noncoding transcript Het
Hgf A C 5: 16,614,894 N541T probably benign Het
Hipk2 G A 6: 38,818,879 P152S probably benign Het
Jarid2 C T 13: 44,906,565 L720F probably damaging Het
Kifc5b A G 17: 26,924,787 E511G probably damaging Het
Ldlr G A 9: 21,735,242 A235T probably benign Het
Lmln A G 16: 33,074,180 D231G possibly damaging Het
Lrp1 A G 10: 127,567,495 C2070R probably damaging Het
Mbl1 A G 14: 41,158,724 T190A possibly damaging Het
Mpdz A T 4: 81,381,697 S355T probably benign Het
Muc19 C T 15: 91,888,138 noncoding transcript Het
Mycbp2 A C 14: 103,139,235 probably null Het
Naa20 T C 2: 145,915,842 S164P probably damaging Het
Nme4 A T 17: 26,093,833 probably benign Het
Npas2 A T 1: 39,347,506 R619* probably null Het
Nudt19 G A 7: 35,555,746 T20I possibly damaging Het
Olfr1224-ps1 T A 2: 89,156,939 K79* probably null Het
Olfr1447 A G 19: 12,901,001 Y260H probably damaging Het
Pitpnc1 A G 11: 107,296,228 Y90H possibly damaging Het
Rcor2 A G 19: 7,269,785 T6A probably benign Het
Rif1 T A 2: 52,109,928 S1131R probably damaging Het
Rtkn T A 6: 83,150,991 D377E probably benign Het
Rtn4rl2 T A 2: 84,872,502 N242I probably damaging Het
Sbno2 G A 10: 80,062,188 L719F probably benign Het
Scn11a G T 9: 119,819,831 D55E probably damaging Het
Setd1b T A 5: 123,151,866 I632N unknown Het
Srpk2 A T 5: 23,524,392 D416E possibly damaging Het
Sspo A T 6: 48,466,955 probably null Het
Sycp1 A T 3: 102,845,054 I804N probably benign Het
Tdp2 G A 13: 24,831,826 R32Q probably benign Het
Tgfbr3 A G 5: 107,136,929 V618A possibly damaging Het
Tmc3 C T 7: 83,609,118 P439S probably benign Het
Tnxb A T 17: 34,717,483 D2740V probably damaging Het
Tspyl4 A G 10: 34,297,937 T142A probably benign Het
Ttn T C 2: 76,880,441 probably benign Het
Tubgcp4 T C 2: 121,173,580 L34P probably damaging Het
Tubgcp6 G T 15: 89,099,545 probably benign Het
Unc79 T A 12: 103,112,703 V1690E probably benign Het
Vps4b T C 1: 106,796,418 probably null Het
Wtap A G 17: 12,967,638 S341P possibly damaging Het
Wwc1 T C 11: 35,883,345 T363A probably benign Het
Zbtb8a G A 4: 129,360,500 T67M probably damaging Het
Zfp865 T C 7: 5,034,669 probably benign Het
Other mutations in Spaca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Spaca6 APN 17 17831167 missense probably benign 0.41
IGL02630:Spaca6 APN 17 17831089 missense probably damaging 1.00
IGL03010:Spaca6 APN 17 17838405 missense probably benign 0.01
IGL03352:Spaca6 APN 17 17838139 missense probably damaging 1.00
R0021:Spaca6 UTSW 17 17838236 nonsense probably null
R0964:Spaca6 UTSW 17 17838391 missense possibly damaging 0.46
R1941:Spaca6 UTSW 17 17838402 missense probably benign 0.05
R1941:Spaca6 UTSW 17 17838430 missense probably damaging 0.99
R2197:Spaca6 UTSW 17 17836154 critical splice donor site probably null
R2235:Spaca6 UTSW 17 17838245 critical splice donor site probably null
R4602:Spaca6 UTSW 17 17831125 missense probably damaging 0.99
R4645:Spaca6 UTSW 17 17836045 intron probably benign
R4672:Spaca6 UTSW 17 17836743 nonsense probably null
R5212:Spaca6 UTSW 17 17838394 missense probably benign 0.01
R5222:Spaca6 UTSW 17 17838105 missense probably benign 0.02
R5528:Spaca6 UTSW 17 17831082 missense probably benign
R5854:Spaca6 UTSW 17 17831247 nonsense probably null
R6029:Spaca6 UTSW 17 17831196 missense probably benign 0.00
R7041:Spaca6 UTSW 17 17836096 missense probably benign 0.14
R7268:Spaca6 UTSW 17 17832107 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TATCTTCTCCTCAGACCCGGA -3'
(R):5'- GTCTCCACCCCACTCTGGAC -3'

Sequencing Primer
(F):5'- ACCCGGAGACCCTCTGTTATG -3'
(R):5'- ACCCCACTCTGGACCTGTTTC -3'
Posted On2016-06-15