Mutagenetix > Incidental Mutations

Incidental Mutation 'R5045:Disp2'

394300

Institutional Source

Beutler Lab

Gene Symbol

Disp2

Ensembl Gene

ENSMUSG00000040035

Gene Name

dispatched RND tramsporter family member 2

Synonyms

B230210L08Rik, DispB

MMRRC Submission

042635-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.851) question?

Stock #

R5045 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118779719-118811293 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 118792062 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 1092 (E1092K)

Ref Sequence

ENSEMBL: ENSMUSP00000037136 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037547] [ENSMUST00000063975] [ENSMUST00000110843] [ENSMUST00000110846]

Predicted Effect

probably benign
Transcript: ENSMUST00000037547
AA Change: E1092K

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000037136
Gene: ENSMUSG00000040035
AA Change: E1092K

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC
Pfam:MMPL	435	635	9.7e-8	PFAM
Pfam:Sterol-sensing	458	611	9.1e-9	PFAM
transmembrane domain	657	679	N/A	INTRINSIC
low complexity region	682	695	N/A	INTRINSIC
low complexity region	748	761	N/A	INTRINSIC
transmembrane domain	914	936	N/A	INTRINSIC
transmembrane domain	943	965	N/A	INTRINSIC
transmembrane domain	975	997	N/A	INTRINSIC
transmembrane domain	1018	1040	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000063975

SMART Domains

Protein: ENSMUSP00000070031
Gene: ENSMUSG00000040035

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110843

SMART Domains

Protein: ENSMUSP00000106467
Gene: ENSMUSG00000040035

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110846

SMART Domains

Protein: ENSMUSP00000106470
Gene: ENSMUSG00000040035

Domain	Start	End	E-Value	Type
transmembrane domain	123	145	N/A	INTRINSIC
low complexity region	195	203	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142072

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810062G17Rik	T	C	3: 36,476,178		probably benign	Het
2210408I21Rik	A	G	13: 77,267,808		probably null	Het
4930430A15Rik	T	A	2: 111,193,459	Q110L	unknown	Het
4930519P11Rik	G	T	2: 154,613,062		probably benign	Het
4930519P11Rik	A	T	2: 154,613,030	C136*	probably null	Het
Adgrb3	T	A	1: 25,074,779	H1189L	probably damaging	Het
Arhgap24	A	G	5: 102,891,877	I227V	possibly damaging	Het
Arhgap29	C	A	3: 122,002,595	N445K	probably benign	Het
Atp13a3	T	C	16: 30,339,876	H811R	probably benign	Het
Cd2ap	T	C	17: 42,807,960	N529S	probably benign	Het
Cdh7	T	A	1: 110,098,350	S439T	probably benign	Het
Ces3a	G	T	8: 105,050,616		probably null	Het
Cftr	T	A	6: 18,230,081	N408K	probably benign	Het
Chil5	T	C	3: 106,024,140	N136S	possibly damaging	Het
Col20a1	A	G	2: 181,006,845	D933G	probably damaging	Het
Crh	A	T	3: 19,693,989	L163*	probably null	Het
Ctps	A	C	4: 120,552,878		probably null	Het
Cyb5d2	A	G	11: 72,795,575	V63A	probably damaging	Het
Cyp2d11	T	A	15: 82,391,071		probably null	Het
Dclk3	A	T	9: 111,467,788	E133D	probably damaging	Het
Dhrs9	A	G	2: 69,392,995	D29G	probably benign	Het
Enpp3	A	G	10: 24,776,767	I764T	probably damaging	Het
Epm2aip1	C	A	9: 111,273,359	R467S	possibly damaging	Het
Fam20a	T	C	11: 109,677,885	I272V	probably benign	Het
Fgb	T	C	3: 83,043,373	Y358C	probably damaging	Het
Gm11596	A	T	11: 99,792,869	S142T	unknown	Het
Gm4858	G	T	3: 93,074,217	D181Y	probably damaging	Het
Golga4	A	G	9: 118,565,656	T9A	probably benign	Het
Hmcn2	C	T	2: 31,409,081	P2813L	probably damaging	Het
Ighv1-9	C	T	12: 114,583,820	G34R	probably damaging	Het
Kalrn	A	C	16: 34,314,352	Y353*	probably null	Het
Klrk1	T	C	6: 129,617,503	Y42C	probably benign	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Mbtd1	T	C	11: 93,931,815	Y484H	probably benign	Het
Mki67	T	C	7: 135,707,904	R273G	possibly damaging	Het
Myh11	A	T	16: 14,239,527	L308*	probably null	Het
Nacc2	G	A	2: 26,090,138		probably null	Het
Nadsyn1	A	G	7: 143,806,969	L354P	probably damaging	Het
Ntrk3	T	A	7: 78,460,424	Q354L	probably benign	Het
Olfr1124	A	T	2: 87,435,146	I220L	probably damaging	Het
Olfr584	G	A	7: 103,086,457	G308E	probably benign	Het
Phactr3	T	C	2: 178,331,619	I470T	probably damaging	Het
Pkd1l3	C	T	8: 109,623,155	P211S	unknown	Het
Prickle2	T	C	6: 92,376,394	D753G	probably damaging	Het
Prr12	A	G	7: 45,049,894		probably benign	Het
Psd3	T	C	8: 67,713,825	E917G	probably damaging	Het
Rgsl1	T	A	1: 153,821,522	K551*	probably null	Het
Stag3	T	C	5: 138,304,478	L1033P	probably damaging	Het
Tcaf3	T	A	6: 42,593,684	Q378L	possibly damaging	Het
Tespa1	A	T	10: 130,362,035	K309*	probably null	Het
Trim69	A	G	2: 122,174,246	T275A	probably benign	Het
Txndc17	T	C	11: 72,207,711	Y30H	probably damaging	Het
Ugt2a2	A	T	5: 87,474,892	F72L	probably damaging	Het
Vmn2r59	A	T	7: 42,046,072	D305E	possibly damaging	Het
Vmn2r71	A	G	7: 85,624,389	I804V	probably benign	Het
Zfy2	T	C	Y: 2,107,159	K492E	possibly damaging	Het
Zkscan1	A	G	5: 138,100,920	H375R	probably damaging	Het

Other mutations in Disp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Disp2	APN	2	118786278	missense	probably damaging	1.00
IGL00970:Disp2	APN	2	118791793	missense	probably damaging	1.00
IGL01790:Disp2	APN	2	118790880	missense	probably damaging	1.00
IGL01809:Disp2	APN	2	118787264	splice site	probably benign
IGL02069:Disp2	APN	2	118790680	missense	possibly damaging	0.93
IGL02140:Disp2	APN	2	118790869	missense	probably benign
IGL02143:Disp2	APN	2	118789969	missense	probably damaging	1.00
IGL02155:Disp2	APN	2	118791804	missense	probably damaging	1.00
IGL02884:Disp2	APN	2	118787551	splice site	probably benign
IGL03113:Disp2	APN	2	118790778	splice site	probably null
IGL03194:Disp2	APN	2	118787629	missense	probably damaging	1.00
PIT4453001:Disp2	UTSW	2	118787644	missense	probably benign	0.01
R0109:Disp2	UTSW	2	118791816	missense	probably damaging	1.00
R0126:Disp2	UTSW	2	118790338	missense	probably damaging	1.00
R0603:Disp2	UTSW	2	118792006	missense	probably damaging	1.00
R0610:Disp2	UTSW	2	118792236	missense	probably benign	0.02
R0639:Disp2	UTSW	2	118790844	missense	possibly damaging	0.74
R0673:Disp2	UTSW	2	118790844	missense	possibly damaging	0.74
R0755:Disp2	UTSW	2	118789762	missense	probably benign	0.00
R0781:Disp2	UTSW	2	118790439	missense	probably damaging	1.00
R1110:Disp2	UTSW	2	118790439	missense	probably damaging	1.00
R1148:Disp2	UTSW	2	118806418	critical splice donor site	probably null
R1148:Disp2	UTSW	2	118806418	critical splice donor site	probably null
R1243:Disp2	UTSW	2	118791822	missense	probably damaging	1.00
R1587:Disp2	UTSW	2	118791583	missense	probably damaging	1.00
R1739:Disp2	UTSW	2	118791550	missense	probably damaging	1.00
R1771:Disp2	UTSW	2	118791297	nonsense	probably null
R1781:Disp2	UTSW	2	118792561	missense	probably damaging	0.96
R1918:Disp2	UTSW	2	118791927	missense	probably benign
R1956:Disp2	UTSW	2	118792223	missense	probably benign	0.02
R2167:Disp2	UTSW	2	118791685	missense	probably damaging	1.00
R2206:Disp2	UTSW	2	118792244	missense	probably benign	0.02
R4031:Disp2	UTSW	2	118791880	missense	probably benign	0.27
R4617:Disp2	UTSW	2	118790162	missense	probably benign
R4656:Disp2	UTSW	2	118790563	missense	probably damaging	1.00
R4684:Disp2	UTSW	2	118792756	missense	probably damaging	1.00
R4696:Disp2	UTSW	2	118791684	nonsense	probably null
R4697:Disp2	UTSW	2	118791684	nonsense	probably null
R4738:Disp2	UTSW	2	118790326	missense	probably damaging	0.97
R4834:Disp2	UTSW	2	118792504	missense	probably benign	0.09
R4914:Disp2	UTSW	2	118790454	missense	probably damaging	0.99
R4915:Disp2	UTSW	2	118790454	missense	probably damaging	0.99
R4918:Disp2	UTSW	2	118790454	missense	probably damaging	0.99
R5208:Disp2	UTSW	2	118791805	missense	probably damaging	1.00
R5303:Disp2	UTSW	2	118810848	unclassified	probably benign
R5350:Disp2	UTSW	2	118787575	missense	probably benign	0.23
R5355:Disp2	UTSW	2	118786911	missense	probably benign	0.00
R6011:Disp2	UTSW	2	118790820	missense	possibly damaging	0.65
R6031:Disp2	UTSW	2	118789794	missense	probably benign	0.01
R6031:Disp2	UTSW	2	118789794	missense	probably benign	0.01
R6139:Disp2	UTSW	2	118790662	missense	probably damaging	0.97
R6169:Disp2	UTSW	2	118791550	missense	probably damaging	1.00
R6187:Disp2	UTSW	2	118792143	missense	probably damaging	1.00
R6209:Disp2	UTSW	2	118786921	missense	probably damaging	1.00
R6250:Disp2	UTSW	2	118790766	missense	probably damaging	1.00
R6392:Disp2	UTSW	2	118790749	missense	probably damaging	1.00
R7138:Disp2	UTSW	2	118786880	missense	probably benign
R7156:Disp2	UTSW	2	118791811	missense	probably damaging	1.00
R7230:Disp2	UTSW	2	118791805	missense	probably damaging	1.00
R7400:Disp2	UTSW	2	118791886	missense	probably damaging	1.00
R7460:Disp2	UTSW	2	118789780	missense	probably damaging	1.00
R7505:Disp2	UTSW	2	118791088	missense	probably damaging	1.00
R7542:Disp2	UTSW	2	118791118	missense	probably damaging	0.97
R7728:Disp2	UTSW	2	118791480	missense	probably benign	0.31
R7757:Disp2	UTSW	2	118790910	missense	probably damaging	1.00
R7798:Disp2	UTSW	2	118791879	missense	probably benign
R7945:Disp2	UTSW	2	118792789	missense	probably damaging	1.00
R8013:Disp2	UTSW	2	118789682	nonsense	probably null
R8085:Disp2	UTSW	2	118786971	missense	possibly damaging	0.94
R8179:Disp2	UTSW	2	118792549	missense	probably damaging	0.99
R8288:Disp2	UTSW	2	118790281	missense	probably damaging	1.00
R8345:Disp2	UTSW	2	118810803	missense	unknown
R8385:Disp2	UTSW	2	118790410	missense	probably damaging	1.00
Z1177:Disp2	UTSW	2	118789702	missense	probably damaging	0.99
Z1177:Disp2	UTSW	2	118790827	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTTACGTCAGATCAGCCGG -3'
(R):5'- GCCATCATGTATCTGCAGGTC -3'

Sequencing Primer
(F):5'- CTCTGGTGTGATCATGCTGCC -3'
(R):5'- CATCATGTATCTGCAGGTCTTCAGAG -3'

Posted On

2016-06-15