Mutagenetix > Incidental Mutations

Incidental Mutation 'R5045:Trim69'

394301

Institutional Source

Beutler Lab

Gene Symbol

Trim69

Ensembl Gene

ENSMUSG00000033368

Gene Name

tripartite motif-containing 69

Synonyms

4921519C19Rik, Rnf36, Trif

MMRRC Submission

042635-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R5045 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

122160700-122179027 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122174246 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 275 (T275A)

Ref Sequence

ENSEMBL: ENSMUSP00000047627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028665] [ENSMUST00000036089]

Predicted Effect

probably benign
Transcript: ENSMUST00000028665

SMART Domains

Protein: ENSMUSP00000028665
Gene: ENSMUSG00000027233

Domain	Start	End	E-Value	Type
low complexity region	33	41	N/A	INTRINSIC
low complexity region	143	165	N/A	INTRINSIC
low complexity region	215	227	N/A	INTRINSIC
Pfam:PAT1	247	490	6.7e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000036089
AA Change: T275A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000047627
Gene: ENSMUSG00000033368
AA Change: T275A

Domain	Start	End	E-Value	Type
RING	42	82	8.48e-8	SMART
low complexity region	95	111	N/A	INTRINSIC
PDB:4NQJ\|C	144	322	2e-86	PDB
PRY	323	375	9.37e-19	SMART
SPRY	376	500	4.97e-24	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143088

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING-B-box-coiled-coil (RBCC) family and encodes a protein with an N-terminal RING finger motif, a PRY domain and a C-terminal SPRY domain. The mouse ortholog of this gene is specifically expressed in germ cells at the round spermatid stages during spermatogenesis and, when overexpressed, induces apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810062G17Rik	T	C	3: 36,476,178		probably benign	Het
2210408I21Rik	A	G	13: 77,267,808		probably null	Het
4930430A15Rik	T	A	2: 111,193,459	Q110L	unknown	Het
4930519P11Rik	A	T	2: 154,613,030	C136*	probably null	Het
4930519P11Rik	G	T	2: 154,613,062		probably benign	Het
Adgrb3	T	A	1: 25,074,779	H1189L	probably damaging	Het
Arhgap24	A	G	5: 102,891,877	I227V	possibly damaging	Het
Arhgap29	C	A	3: 122,002,595	N445K	probably benign	Het
Atp13a3	T	C	16: 30,339,876	H811R	probably benign	Het
Cd2ap	T	C	17: 42,807,960	N529S	probably benign	Het
Cdh7	T	A	1: 110,098,350	S439T	probably benign	Het
Ces3a	G	T	8: 105,050,616		probably null	Het
Cftr	T	A	6: 18,230,081	N408K	probably benign	Het
Chil5	T	C	3: 106,024,140	N136S	possibly damaging	Het
Col20a1	A	G	2: 181,006,845	D933G	probably damaging	Het
Crh	A	T	3: 19,693,989	L163*	probably null	Het
Ctps	A	C	4: 120,552,878		probably null	Het
Cyb5d2	A	G	11: 72,795,575	V63A	probably damaging	Het
Cyp2d11	T	A	15: 82,391,071		probably null	Het
Dclk3	A	T	9: 111,467,788	E133D	probably damaging	Het
Dhrs9	A	G	2: 69,392,995	D29G	probably benign	Het
Disp2	G	A	2: 118,792,062	E1092K	probably benign	Het
Enpp3	A	G	10: 24,776,767	I764T	probably damaging	Het
Epm2aip1	C	A	9: 111,273,359	R467S	possibly damaging	Het
Fam20a	T	C	11: 109,677,885	I272V	probably benign	Het
Fgb	T	C	3: 83,043,373	Y358C	probably damaging	Het
Gm11596	A	T	11: 99,792,869	S142T	unknown	Het
Gm4858	G	T	3: 93,074,217	D181Y	probably damaging	Het
Golga4	A	G	9: 118,565,656	T9A	probably benign	Het
Hmcn2	C	T	2: 31,409,081	P2813L	probably damaging	Het
Ighv1-9	C	T	12: 114,583,820	G34R	probably damaging	Het
Kalrn	A	C	16: 34,314,352	Y353*	probably null	Het
Klrk1	T	C	6: 129,617,503	Y42C	probably benign	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Mbtd1	T	C	11: 93,931,815	Y484H	probably benign	Het
Mki67	T	C	7: 135,707,904	R273G	possibly damaging	Het
Myh11	A	T	16: 14,239,527	L308*	probably null	Het
Nacc2	G	A	2: 26,090,138		probably null	Het
Nadsyn1	A	G	7: 143,806,969	L354P	probably damaging	Het
Ntrk3	T	A	7: 78,460,424	Q354L	probably benign	Het
Olfr1124	A	T	2: 87,435,146	I220L	probably damaging	Het
Olfr584	G	A	7: 103,086,457	G308E	probably benign	Het
Phactr3	T	C	2: 178,331,619	I470T	probably damaging	Het
Pkd1l3	C	T	8: 109,623,155	P211S	unknown	Het
Prickle2	T	C	6: 92,376,394	D753G	probably damaging	Het
Prr12	A	G	7: 45,049,894		probably benign	Het
Psd3	T	C	8: 67,713,825	E917G	probably damaging	Het
Rgsl1	T	A	1: 153,821,522	K551*	probably null	Het
Stag3	T	C	5: 138,304,478	L1033P	probably damaging	Het
Tcaf3	T	A	6: 42,593,684	Q378L	possibly damaging	Het
Tespa1	A	T	10: 130,362,035	K309*	probably null	Het
Txndc17	T	C	11: 72,207,711	Y30H	probably damaging	Het
Ugt2a2	A	T	5: 87,474,892	F72L	probably damaging	Het
Vmn2r59	A	T	7: 42,046,072	D305E	possibly damaging	Het
Vmn2r71	A	G	7: 85,624,389	I804V	probably benign	Het
Zfy2	T	C	Y: 2,107,159	K492E	possibly damaging	Het
Zkscan1	A	G	5: 138,100,920	H375R	probably damaging	Het

Other mutations in Trim69

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00663:Trim69	APN	2	122167714	missense	probably benign	0.00
IGL01321:Trim69	APN	2	122173284	missense	possibly damaging	0.84
IGL01478:Trim69	APN	2	122178443	missense	probably damaging	0.98
IGL01907:Trim69	APN	2	122167661	missense	probably benign	0.00
IGL01925:Trim69	APN	2	122167916	missense	probably damaging	1.00
IGL03065:Trim69	APN	2	122178634	missense	probably damaging	0.98
IGL03121:Trim69	APN	2	122167647	missense	probably benign	0.22
IGL03206:Trim69	APN	2	122173155	missense	probably benign	0.00
R0019:Trim69	UTSW	2	122174477	splice site	probably null
R0019:Trim69	UTSW	2	122174477	splice site	probably null
R1956:Trim69	UTSW	2	122174475	critical splice donor site	probably null
R1960:Trim69	UTSW	2	122167684	missense	probably benign	0.00
R2212:Trim69	UTSW	2	122178644	missense	probably benign	0.05
R3412:Trim69	UTSW	2	122178644	missense	probably benign	0.05
R3414:Trim69	UTSW	2	122178644	missense	probably benign	0.05
R3900:Trim69	UTSW	2	122178841	missense	probably benign	0.03
R4470:Trim69	UTSW	2	122178599	missense	probably damaging	1.00
R4950:Trim69	UTSW	2	122178746	missense	probably damaging	1.00
R5237:Trim69	UTSW	2	122173340	missense	probably benign
R5931:Trim69	UTSW	2	122178594	missense	probably damaging	0.98
R6483:Trim69	UTSW	2	122167600	nonsense	probably null
R6872:Trim69	UTSW	2	122167910	missense	probably damaging	1.00
R7372:Trim69	UTSW	2	122178583	missense	possibly damaging	0.94
R7451:Trim69	UTSW	2	122168027	missense	probably benign	0.19
R7591:Trim69	UTSW	2	122167973	missense	probably benign	0.17
R8353:Trim69	UTSW	2	122168009	missense	possibly damaging	0.73
R8551:Trim69	UTSW	2	122173329	missense	probably benign	0.00
Z1176:Trim69	UTSW	2	122167554	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TAGCCTGGGATGCTGCTTAG -3'
(R):5'- GCATTTCCTTCCAGATGATATACTGG -3'

Sequencing Primer
(F):5'- GCTGCTTAGCAAAGTCTGTAGAG -3'
(R):5'- TAGGACCTTTGAAGCGGCCTAG -3'

Posted On

2016-06-15