Incidental Mutation 'R5045:Crh'
ID394305
Institutional Source Beutler Lab
Gene Symbol Crh
Ensembl Gene ENSMUSG00000049796
Gene Namecorticotropin releasing hormone
Synonymscorticotropin releasing factor, corticotropin-releasing factor, CRF, LOC383938
MMRRC Submission 042635-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.521) question?
Stock #R5045 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location19693401-19695396 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 19693989 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 163 (L163*)
Ref Sequence ENSEMBL: ENSMUSP00000061185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029139] [ENSMUST00000061294]
Predicted Effect probably benign
Transcript: ENSMUST00000029139
SMART Domains Protein: ENSMUSP00000029139
Gene: ENSMUSG00000060913

DomainStartEndE-ValueType
RING 26 81 3.69e-8 SMART
BBOX 119 161 3.58e-6 SMART
Blast:BBC 168 294 2e-33 BLAST
PDB:4M3L|D 215 272 2e-12 PDB
low complexity region 329 355 N/A INTRINSIC
low complexity region 384 398 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 514 526 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000061294
AA Change: L163*
SMART Domains Protein: ENSMUSP00000061185
Gene: ENSMUSG00000049796
AA Change: L163*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 38 56 N/A INTRINSIC
CRF 146 185 1.55e-16 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the corticotropin-releasing factor family and preproprotein that is proteolytically processed to generate a mature protein product. This protein product is a neuropeptide hormone that binds to the corticotropin releasing hormone receptors (CRHR1 and CRHR2) to stimulate the release of adrenocorticotropic hormone from the pituitary gland in response to stress. The encoded protein may also regulate angiogenesis and inflammation. Homozygous knockout mice for this gene exhibit reduced corticosterone levels while the offspring of these mice die perinatally. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice have abnormal adrenal gland morphology, decreased corticosterone levels and abnormal corticosteroid responses to stress. Homozygous litters born from homozygous females display neonatal lethality, impaired lung maturation and delayedcornified and granular layer development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,476,178 probably benign Het
2210408I21Rik A G 13: 77,267,808 probably null Het
4930430A15Rik T A 2: 111,193,459 Q110L unknown Het
4930519P11Rik A T 2: 154,613,030 C136* probably null Het
4930519P11Rik G T 2: 154,613,062 probably benign Het
Adgrb3 T A 1: 25,074,779 H1189L probably damaging Het
Arhgap24 A G 5: 102,891,877 I227V possibly damaging Het
Arhgap29 C A 3: 122,002,595 N445K probably benign Het
Atp13a3 T C 16: 30,339,876 H811R probably benign Het
Cd2ap T C 17: 42,807,960 N529S probably benign Het
Cdh7 T A 1: 110,098,350 S439T probably benign Het
Ces3a G T 8: 105,050,616 probably null Het
Cftr T A 6: 18,230,081 N408K probably benign Het
Chil5 T C 3: 106,024,140 N136S possibly damaging Het
Col20a1 A G 2: 181,006,845 D933G probably damaging Het
Ctps A C 4: 120,552,878 probably null Het
Cyb5d2 A G 11: 72,795,575 V63A probably damaging Het
Cyp2d11 T A 15: 82,391,071 probably null Het
Dclk3 A T 9: 111,467,788 E133D probably damaging Het
Dhrs9 A G 2: 69,392,995 D29G probably benign Het
Disp2 G A 2: 118,792,062 E1092K probably benign Het
Enpp3 A G 10: 24,776,767 I764T probably damaging Het
Epm2aip1 C A 9: 111,273,359 R467S possibly damaging Het
Fam20a T C 11: 109,677,885 I272V probably benign Het
Fgb T C 3: 83,043,373 Y358C probably damaging Het
Gm11596 A T 11: 99,792,869 S142T unknown Het
Gm4858 G T 3: 93,074,217 D181Y probably damaging Het
Golga4 A G 9: 118,565,656 T9A probably benign Het
Hmcn2 C T 2: 31,409,081 P2813L probably damaging Het
Ighv1-9 C T 12: 114,583,820 G34R probably damaging Het
Kalrn A C 16: 34,314,352 Y353* probably null Het
Klrk1 T C 6: 129,617,503 Y42C probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mbtd1 T C 11: 93,931,815 Y484H probably benign Het
Mki67 T C 7: 135,707,904 R273G possibly damaging Het
Myh11 A T 16: 14,239,527 L308* probably null Het
Nacc2 G A 2: 26,090,138 probably null Het
Nadsyn1 A G 7: 143,806,969 L354P probably damaging Het
Ntrk3 T A 7: 78,460,424 Q354L probably benign Het
Olfr1124 A T 2: 87,435,146 I220L probably damaging Het
Olfr584 G A 7: 103,086,457 G308E probably benign Het
Phactr3 T C 2: 178,331,619 I470T probably damaging Het
Pkd1l3 C T 8: 109,623,155 P211S unknown Het
Prickle2 T C 6: 92,376,394 D753G probably damaging Het
Prr12 A G 7: 45,049,894 probably benign Het
Psd3 T C 8: 67,713,825 E917G probably damaging Het
Rgsl1 T A 1: 153,821,522 K551* probably null Het
Stag3 T C 5: 138,304,478 L1033P probably damaging Het
Tcaf3 T A 6: 42,593,684 Q378L possibly damaging Het
Tespa1 A T 10: 130,362,035 K309* probably null Het
Trim69 A G 2: 122,174,246 T275A probably benign Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Ugt2a2 A T 5: 87,474,892 F72L probably damaging Het
Vmn2r59 A T 7: 42,046,072 D305E possibly damaging Het
Vmn2r71 A G 7: 85,624,389 I804V probably benign Het
Zfy2 T C Y: 2,107,159 K492E possibly damaging Het
Zkscan1 A G 5: 138,100,920 H375R probably damaging Het
Other mutations in Crh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02698:Crh APN 3 19694190 missense possibly damaging 0.80
R0047:Crh UTSW 3 19694037 missense probably damaging 1.00
R0697:Crh UTSW 3 19694077 missense probably damaging 0.99
R0835:Crh UTSW 3 19694364 missense probably benign 0.02
R1201:Crh UTSW 3 19693926 missense probably damaging 0.99
R2034:Crh UTSW 3 19694098 missense probably damaging 1.00
R2233:Crh UTSW 3 19693932 missense probably damaging 1.00
R2234:Crh UTSW 3 19693932 missense probably damaging 1.00
R2235:Crh UTSW 3 19693932 missense probably damaging 1.00
R5191:Crh UTSW 3 19693929 missense probably damaging 1.00
R5283:Crh UTSW 3 19694007 missense probably damaging 1.00
R6481:Crh UTSW 3 19694337 missense probably benign 0.13
R6790:Crh UTSW 3 19694295 missense probably damaging 1.00
R6865:Crh UTSW 3 19694140 missense possibly damaging 0.56
R7259:Crh UTSW 3 19694254 missense possibly damaging 0.64
R7758:Crh UTSW 3 19694289 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCGGAGCTGCGATATGGTAC -3'
(R):5'- TCTCAACAGAAGTCCCGCTG -3'

Sequencing Primer
(F):5'- CAGAATCGTTTTGGCCAAG -3'
(R):5'- AGGCTGCGGCTAACTTTTTC -3'
Posted On2016-06-15