Mutagenetix > Incidental Mutations

Incidental Mutation 'R5045:Arhgap29'

394310

Institutional Source

Beutler Lab

Gene Symbol

Arhgap29

Ensembl Gene

ENSMUSG00000039831

Gene Name

Rho GTPase activating protein 29

Synonyms

B130017I01Rik, 6720461J18Rik, C76601, Parg1

MMRRC Submission

042635-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5045 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121952541-122016753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 122002595 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 445 (N445K)

Ref Sequence

ENSEMBL: ENSMUSP00000044624 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037958] [ENSMUST00000197155]

Predicted Effect

probably benign
Transcript: ENSMUST00000037958
AA Change: N445K

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000044624
Gene: ENSMUSG00000039831
AA Change: N445K

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	5e-41	PDB
Blast:RhoGAP	412	595	9e-84	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	885	1.92e-68	SMART
low complexity region	947	961	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197155
AA Change: N445K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000142945
Gene: ENSMUSG00000039831
AA Change: N445K

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	8e-42	PDB
Blast:RhoGAP	412	595	2e-87	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	780	1.14e-6	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000198914
AA Change: N46K

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199550

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rap1 is a small GTPase that, through effectors, regulates Rho GTPase signaling. These effectors- Rasip1, Radil, and the protein encoded by this gene- translocate to the cell membrane, where they form a multiprotein complex. This complex is necessary for Rap1-induced inhibition of Rho signaling. Defects in this gene may be a cause of nonsyndromic cleft lip with or without cleft palate. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810062G17Rik	T	C	3: 36,476,178		probably benign	Het
2210408I21Rik	A	G	13: 77,267,808		probably null	Het
4930430A15Rik	T	A	2: 111,193,459	Q110L	unknown	Het
4930519P11Rik	A	T	2: 154,613,030	C136*	probably null	Het
4930519P11Rik	G	T	2: 154,613,062		probably benign	Het
Adgrb3	T	A	1: 25,074,779	H1189L	probably damaging	Het
Arhgap24	A	G	5: 102,891,877	I227V	possibly damaging	Het
Atp13a3	T	C	16: 30,339,876	H811R	probably benign	Het
Cd2ap	T	C	17: 42,807,960	N529S	probably benign	Het
Cdh7	T	A	1: 110,098,350	S439T	probably benign	Het
Ces3a	G	T	8: 105,050,616		probably null	Het
Cftr	T	A	6: 18,230,081	N408K	probably benign	Het
Chil5	T	C	3: 106,024,140	N136S	possibly damaging	Het
Col20a1	A	G	2: 181,006,845	D933G	probably damaging	Het
Crh	A	T	3: 19,693,989	L163*	probably null	Het
Ctps	A	C	4: 120,552,878		probably null	Het
Cyb5d2	A	G	11: 72,795,575	V63A	probably damaging	Het
Cyp2d11	T	A	15: 82,391,071		probably null	Het
Dclk3	A	T	9: 111,467,788	E133D	probably damaging	Het
Dhrs9	A	G	2: 69,392,995	D29G	probably benign	Het
Disp2	G	A	2: 118,792,062	E1092K	probably benign	Het
Enpp3	A	G	10: 24,776,767	I764T	probably damaging	Het
Epm2aip1	C	A	9: 111,273,359	R467S	possibly damaging	Het
Fam20a	T	C	11: 109,677,885	I272V	probably benign	Het
Fgb	T	C	3: 83,043,373	Y358C	probably damaging	Het
Gm11596	A	T	11: 99,792,869	S142T	unknown	Het
Gm4858	G	T	3: 93,074,217	D181Y	probably damaging	Het
Golga4	A	G	9: 118,565,656	T9A	probably benign	Het
Hmcn2	C	T	2: 31,409,081	P2813L	probably damaging	Het
Ighv1-9	C	T	12: 114,583,820	G34R	probably damaging	Het
Kalrn	A	C	16: 34,314,352	Y353*	probably null	Het
Klrk1	T	C	6: 129,617,503	Y42C	probably benign	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Mbtd1	T	C	11: 93,931,815	Y484H	probably benign	Het
Mki67	T	C	7: 135,707,904	R273G	possibly damaging	Het
Myh11	A	T	16: 14,239,527	L308*	probably null	Het
Nacc2	G	A	2: 26,090,138		probably null	Het
Nadsyn1	A	G	7: 143,806,969	L354P	probably damaging	Het
Ntrk3	T	A	7: 78,460,424	Q354L	probably benign	Het
Olfr1124	A	T	2: 87,435,146	I220L	probably damaging	Het
Olfr584	G	A	7: 103,086,457	G308E	probably benign	Het
Phactr3	T	C	2: 178,331,619	I470T	probably damaging	Het
Pkd1l3	C	T	8: 109,623,155	P211S	unknown	Het
Prickle2	T	C	6: 92,376,394	D753G	probably damaging	Het
Prr12	A	G	7: 45,049,894		probably benign	Het
Psd3	T	C	8: 67,713,825	E917G	probably damaging	Het
Rgsl1	T	A	1: 153,821,522	K551*	probably null	Het
Stag3	T	C	5: 138,304,478	L1033P	probably damaging	Het
Tcaf3	T	A	6: 42,593,684	Q378L	possibly damaging	Het
Tespa1	A	T	10: 130,362,035	K309*	probably null	Het
Trim69	A	G	2: 122,174,246	T275A	probably benign	Het
Txndc17	T	C	11: 72,207,711	Y30H	probably damaging	Het
Ugt2a2	A	T	5: 87,474,892	F72L	probably damaging	Het
Vmn2r59	A	T	7: 42,046,072	D305E	possibly damaging	Het
Vmn2r71	A	G	7: 85,624,389	I804V	probably benign	Het
Zfy2	T	C	Y: 2,107,159	K492E	possibly damaging	Het
Zkscan1	A	G	5: 138,100,920	H375R	probably damaging	Het

Other mutations in Arhgap29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Arhgap29	APN	3	122003312	nonsense	probably null
IGL01121:Arhgap29	APN	3	122009863	missense	probably damaging	1.00
IGL01622:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01623:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01995:Arhgap29	APN	3	122014328	missense	probably benign	0.00
IGL02120:Arhgap29	APN	3	122004257	missense	probably benign	0.05
IGL02554:Arhgap29	APN	3	121992524	unclassified	probably benign
IGL02931:Arhgap29	APN	3	121992860	missense	probably benign
IGL02937:Arhgap29	APN	3	121974049	missense	probably damaging	0.99
PIT4362001:Arhgap29	UTSW	3	122003212	missense	probably benign	0.42
R0022:Arhgap29	UTSW	3	121988937	missense	possibly damaging	0.61
R0574:Arhgap29	UTSW	3	122007625	missense	probably benign	0.01
R0601:Arhgap29	UTSW	3	121991110	missense	probably damaging	1.00
R0639:Arhgap29	UTSW	3	122007641	missense	probably damaging	1.00
R0881:Arhgap29	UTSW	3	122014679	missense	probably damaging	1.00
R1232:Arhgap29	UTSW	3	122003340	missense	probably damaging	1.00
R1295:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1296:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1470:Arhgap29	UTSW	3	121992319	unclassified	probably benign
R1710:Arhgap29	UTSW	3	122008080	missense	probably damaging	1.00
R1878:Arhgap29	UTSW	3	122011371	missense	probably damaging	1.00
R2051:Arhgap29	UTSW	3	121981860	missense	probably benign	0.01
R2112:Arhgap29	UTSW	3	122011561	missense	probably benign	0.03
R2188:Arhgap29	UTSW	3	121991009	missense	probably damaging	1.00
R2240:Arhgap29	UTSW	3	122011453	missense	probably benign	0.12
R2420:Arhgap29	UTSW	3	121973980	missense	probably benign
R3618:Arhgap29	UTSW	3	121988527	missense	possibly damaging	0.62
R4673:Arhgap29	UTSW	3	122014971	missense	probably damaging	1.00
R4717:Arhgap29	UTSW	3	122009958	missense	possibly damaging	0.82
R5028:Arhgap29	UTSW	3	122010060	critical splice donor site	probably null
R5043:Arhgap29	UTSW	3	121974004	missense	probably benign	0.00
R5463:Arhgap29	UTSW	3	121988551	missense	possibly damaging	0.94
R5495:Arhgap29	UTSW	3	122014929	missense	probably damaging	1.00
R5743:Arhgap29	UTSW	3	121981911	missense	probably damaging	1.00
R5791:Arhgap29	UTSW	3	122014245	missense	probably damaging	0.98
R5896:Arhgap29	UTSW	3	122012087	missense	possibly damaging	0.78
R6083:Arhgap29	UTSW	3	121992748	missense	probably benign	0.00
R6355:Arhgap29	UTSW	3	122011258	missense	possibly damaging	0.46
R6451:Arhgap29	UTSW	3	121993581	missense	probably damaging	1.00
R6528:Arhgap29	UTSW	3	122014702	missense	probably benign	0.13
R7239:Arhgap29	UTSW	3	121988950	missense	probably benign	0.16
R7669:Arhgap29	UTSW	3	121992812	missense	probably damaging	1.00
R7807:Arhgap29	UTSW	3	122014332	missense	probably benign	0.01
R8048:Arhgap29	UTSW	3	121992901	missense	not run

Predicted Primers

PCR Primer
(F):5'- CCAATCTAAGCTGTGCATAGCATG -3'
(R):5'- CGTGTGAAAATAGAAAGCATCATCC -3'

Sequencing Primer
(F):5'- GCTGATGGTAATATCAGTGT -3'
(R):5'- TGAAAATAGAAAGCATCATCCTCAAG -3'

Posted On

2016-06-15