Incidental Mutation 'R5045:Arhgap29'
ID394310
Institutional Source Beutler Lab
Gene Symbol Arhgap29
Ensembl Gene ENSMUSG00000039831
Gene NameRho GTPase activating protein 29
SynonymsB130017I01Rik, 6720461J18Rik, C76601, Parg1
MMRRC Submission 042635-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5045 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location121952541-122016753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 122002595 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 445 (N445K)
Ref Sequence ENSEMBL: ENSMUSP00000044624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037958] [ENSMUST00000197155]
Predicted Effect probably benign
Transcript: ENSMUST00000037958
AA Change: N445K

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000044624
Gene: ENSMUSG00000039831
AA Change: N445K

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
PDB:3QWE|A 193 469 5e-41 PDB
Blast:RhoGAP 412 595 9e-84 BLAST
C1 613 659 2.48e-6 SMART
RhoGAP 684 885 1.92e-68 SMART
low complexity region 947 961 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197155
AA Change: N445K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000142945
Gene: ENSMUSG00000039831
AA Change: N445K

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
PDB:3QWE|A 193 469 8e-42 PDB
Blast:RhoGAP 412 595 2e-87 BLAST
C1 613 659 2.48e-6 SMART
RhoGAP 684 780 1.14e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000198914
AA Change: N46K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199550
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rap1 is a small GTPase that, through effectors, regulates Rho GTPase signaling. These effectors- Rasip1, Radil, and the protein encoded by this gene- translocate to the cell membrane, where they form a multiprotein complex. This complex is necessary for Rap1-induced inhibition of Rho signaling. Defects in this gene may be a cause of nonsyndromic cleft lip with or without cleft palate. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,476,178 probably benign Het
2210408I21Rik A G 13: 77,267,808 probably null Het
4930430A15Rik T A 2: 111,193,459 Q110L unknown Het
4930519P11Rik A T 2: 154,613,030 C136* probably null Het
4930519P11Rik G T 2: 154,613,062 probably benign Het
Adgrb3 T A 1: 25,074,779 H1189L probably damaging Het
Arhgap24 A G 5: 102,891,877 I227V possibly damaging Het
Atp13a3 T C 16: 30,339,876 H811R probably benign Het
Cd2ap T C 17: 42,807,960 N529S probably benign Het
Cdh7 T A 1: 110,098,350 S439T probably benign Het
Ces3a G T 8: 105,050,616 probably null Het
Cftr T A 6: 18,230,081 N408K probably benign Het
Chil5 T C 3: 106,024,140 N136S possibly damaging Het
Col20a1 A G 2: 181,006,845 D933G probably damaging Het
Crh A T 3: 19,693,989 L163* probably null Het
Ctps A C 4: 120,552,878 probably null Het
Cyb5d2 A G 11: 72,795,575 V63A probably damaging Het
Cyp2d11 T A 15: 82,391,071 probably null Het
Dclk3 A T 9: 111,467,788 E133D probably damaging Het
Dhrs9 A G 2: 69,392,995 D29G probably benign Het
Disp2 G A 2: 118,792,062 E1092K probably benign Het
Enpp3 A G 10: 24,776,767 I764T probably damaging Het
Epm2aip1 C A 9: 111,273,359 R467S possibly damaging Het
Fam20a T C 11: 109,677,885 I272V probably benign Het
Fgb T C 3: 83,043,373 Y358C probably damaging Het
Gm11596 A T 11: 99,792,869 S142T unknown Het
Gm4858 G T 3: 93,074,217 D181Y probably damaging Het
Golga4 A G 9: 118,565,656 T9A probably benign Het
Hmcn2 C T 2: 31,409,081 P2813L probably damaging Het
Ighv1-9 C T 12: 114,583,820 G34R probably damaging Het
Kalrn A C 16: 34,314,352 Y353* probably null Het
Klrk1 T C 6: 129,617,503 Y42C probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mbtd1 T C 11: 93,931,815 Y484H probably benign Het
Mki67 T C 7: 135,707,904 R273G possibly damaging Het
Myh11 A T 16: 14,239,527 L308* probably null Het
Nacc2 G A 2: 26,090,138 probably null Het
Nadsyn1 A G 7: 143,806,969 L354P probably damaging Het
Ntrk3 T A 7: 78,460,424 Q354L probably benign Het
Olfr1124 A T 2: 87,435,146 I220L probably damaging Het
Olfr584 G A 7: 103,086,457 G308E probably benign Het
Phactr3 T C 2: 178,331,619 I470T probably damaging Het
Pkd1l3 C T 8: 109,623,155 P211S unknown Het
Prickle2 T C 6: 92,376,394 D753G probably damaging Het
Prr12 A G 7: 45,049,894 probably benign Het
Psd3 T C 8: 67,713,825 E917G probably damaging Het
Rgsl1 T A 1: 153,821,522 K551* probably null Het
Stag3 T C 5: 138,304,478 L1033P probably damaging Het
Tcaf3 T A 6: 42,593,684 Q378L possibly damaging Het
Tespa1 A T 10: 130,362,035 K309* probably null Het
Trim69 A G 2: 122,174,246 T275A probably benign Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Ugt2a2 A T 5: 87,474,892 F72L probably damaging Het
Vmn2r59 A T 7: 42,046,072 D305E possibly damaging Het
Vmn2r71 A G 7: 85,624,389 I804V probably benign Het
Zfy2 T C Y: 2,107,159 K492E possibly damaging Het
Zkscan1 A G 5: 138,100,920 H375R probably damaging Het
Other mutations in Arhgap29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Arhgap29 APN 3 122003312 nonsense probably null
IGL01121:Arhgap29 APN 3 122009863 missense probably damaging 1.00
IGL01622:Arhgap29 APN 3 121974124 splice site probably benign
IGL01623:Arhgap29 APN 3 121974124 splice site probably benign
IGL01995:Arhgap29 APN 3 122014328 missense probably benign 0.00
IGL02120:Arhgap29 APN 3 122004257 missense probably benign 0.05
IGL02554:Arhgap29 APN 3 121992524 unclassified probably benign
IGL02931:Arhgap29 APN 3 121992860 missense probably benign
IGL02937:Arhgap29 APN 3 121974049 missense probably damaging 0.99
PIT4362001:Arhgap29 UTSW 3 122003212 missense probably benign 0.42
R0022:Arhgap29 UTSW 3 121988937 missense possibly damaging 0.61
R0574:Arhgap29 UTSW 3 122007625 missense probably benign 0.01
R0601:Arhgap29 UTSW 3 121991110 missense probably damaging 1.00
R0639:Arhgap29 UTSW 3 122007641 missense probably damaging 1.00
R0881:Arhgap29 UTSW 3 122014679 missense probably damaging 1.00
R1232:Arhgap29 UTSW 3 122003340 missense probably damaging 1.00
R1295:Arhgap29 UTSW 3 121992395 missense probably benign 0.27
R1296:Arhgap29 UTSW 3 121992395 missense probably benign 0.27
R1403:Arhgap29 UTSW 3 121973929 missense probably damaging 1.00
R1403:Arhgap29 UTSW 3 121973929 missense probably damaging 1.00
R1470:Arhgap29 UTSW 3 121992319 unclassified probably benign
R1710:Arhgap29 UTSW 3 122008080 missense probably damaging 1.00
R1878:Arhgap29 UTSW 3 122011371 missense probably damaging 1.00
R2051:Arhgap29 UTSW 3 121981860 missense probably benign 0.01
R2112:Arhgap29 UTSW 3 122011561 missense probably benign 0.03
R2188:Arhgap29 UTSW 3 121991009 missense probably damaging 1.00
R2240:Arhgap29 UTSW 3 122011453 missense probably benign 0.12
R2420:Arhgap29 UTSW 3 121973980 missense probably benign
R3618:Arhgap29 UTSW 3 121988527 missense possibly damaging 0.62
R4673:Arhgap29 UTSW 3 122014971 missense probably damaging 1.00
R4717:Arhgap29 UTSW 3 122009958 missense possibly damaging 0.82
R5028:Arhgap29 UTSW 3 122010060 critical splice donor site probably null
R5043:Arhgap29 UTSW 3 121974004 missense probably benign 0.00
R5463:Arhgap29 UTSW 3 121988551 missense possibly damaging 0.94
R5495:Arhgap29 UTSW 3 122014929 missense probably damaging 1.00
R5743:Arhgap29 UTSW 3 121981911 missense probably damaging 1.00
R5791:Arhgap29 UTSW 3 122014245 missense probably damaging 0.98
R5896:Arhgap29 UTSW 3 122012087 missense possibly damaging 0.78
R6083:Arhgap29 UTSW 3 121992748 missense probably benign 0.00
R6355:Arhgap29 UTSW 3 122011258 missense possibly damaging 0.46
R6451:Arhgap29 UTSW 3 121993581 missense probably damaging 1.00
R6528:Arhgap29 UTSW 3 122014702 missense probably benign 0.13
R7239:Arhgap29 UTSW 3 121988950 missense probably benign 0.16
R7669:Arhgap29 UTSW 3 121992812 missense probably damaging 1.00
R7807:Arhgap29 UTSW 3 122014332 missense probably benign 0.01
R8048:Arhgap29 UTSW 3 121992901 missense not run
Predicted Primers PCR Primer
(F):5'- CCAATCTAAGCTGTGCATAGCATG -3'
(R):5'- CGTGTGAAAATAGAAAGCATCATCC -3'

Sequencing Primer
(F):5'- GCTGATGGTAATATCAGTGT -3'
(R):5'- TGAAAATAGAAAGCATCATCCTCAAG -3'
Posted On2016-06-15