Incidental Mutation 'R5045:Ctps'
ID394311
Institutional Source Beutler Lab
Gene Symbol Ctps
Ensembl Gene ENSMUSG00000028633
Gene Namecytidine 5'-triphosphate synthase
Synonyms
MMRRC Submission 042635-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R5045 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location120539868-120570276 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 120552878 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030381]
Predicted Effect probably null
Transcript: ENSMUST00000030381
SMART Domains Protein: ENSMUSP00000030381
Gene: ENSMUSG00000028633

DomainStartEndE-ValueType
Pfam:CTP_synth_N 2 277 2.8e-135 PFAM
Pfam:GATase 309 546 6.7e-55 PFAM
Pfam:Peptidase_C26 378 528 3.8e-10 PFAM
low complexity region 565 578 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140891
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme responsible for the catalytic conversion of UTP (uridine triphosphate) to CTP (cytidine triphospate). This reaction is an important step in the biosynthesis of phospholipids and nucleic acids. Activity of this proten is important in the immune system, and loss of function of this gene has been associated with immunodeficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,476,178 probably benign Het
2210408I21Rik A G 13: 77,267,808 probably null Het
4930430A15Rik T A 2: 111,193,459 Q110L unknown Het
4930519P11Rik A T 2: 154,613,030 C136* probably null Het
4930519P11Rik G T 2: 154,613,062 probably benign Het
Adgrb3 T A 1: 25,074,779 H1189L probably damaging Het
Arhgap24 A G 5: 102,891,877 I227V possibly damaging Het
Arhgap29 C A 3: 122,002,595 N445K probably benign Het
Atp13a3 T C 16: 30,339,876 H811R probably benign Het
Cd2ap T C 17: 42,807,960 N529S probably benign Het
Cdh7 T A 1: 110,098,350 S439T probably benign Het
Ces3a G T 8: 105,050,616 probably null Het
Cftr T A 6: 18,230,081 N408K probably benign Het
Chil5 T C 3: 106,024,140 N136S possibly damaging Het
Col20a1 A G 2: 181,006,845 D933G probably damaging Het
Crh A T 3: 19,693,989 L163* probably null Het
Cyb5d2 A G 11: 72,795,575 V63A probably damaging Het
Cyp2d11 T A 15: 82,391,071 probably null Het
Dclk3 A T 9: 111,467,788 E133D probably damaging Het
Dhrs9 A G 2: 69,392,995 D29G probably benign Het
Disp2 G A 2: 118,792,062 E1092K probably benign Het
Enpp3 A G 10: 24,776,767 I764T probably damaging Het
Epm2aip1 C A 9: 111,273,359 R467S possibly damaging Het
Fam20a T C 11: 109,677,885 I272V probably benign Het
Fgb T C 3: 83,043,373 Y358C probably damaging Het
Gm11596 A T 11: 99,792,869 S142T unknown Het
Gm4858 G T 3: 93,074,217 D181Y probably damaging Het
Golga4 A G 9: 118,565,656 T9A probably benign Het
Hmcn2 C T 2: 31,409,081 P2813L probably damaging Het
Ighv1-9 C T 12: 114,583,820 G34R probably damaging Het
Kalrn A C 16: 34,314,352 Y353* probably null Het
Klrk1 T C 6: 129,617,503 Y42C probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mbtd1 T C 11: 93,931,815 Y484H probably benign Het
Mki67 T C 7: 135,707,904 R273G possibly damaging Het
Myh11 A T 16: 14,239,527 L308* probably null Het
Nacc2 G A 2: 26,090,138 probably null Het
Nadsyn1 A G 7: 143,806,969 L354P probably damaging Het
Ntrk3 T A 7: 78,460,424 Q354L probably benign Het
Olfr1124 A T 2: 87,435,146 I220L probably damaging Het
Olfr584 G A 7: 103,086,457 G308E probably benign Het
Phactr3 T C 2: 178,331,619 I470T probably damaging Het
Pkd1l3 C T 8: 109,623,155 P211S unknown Het
Prickle2 T C 6: 92,376,394 D753G probably damaging Het
Prr12 A G 7: 45,049,894 probably benign Het
Psd3 T C 8: 67,713,825 E917G probably damaging Het
Rgsl1 T A 1: 153,821,522 K551* probably null Het
Stag3 T C 5: 138,304,478 L1033P probably damaging Het
Tcaf3 T A 6: 42,593,684 Q378L possibly damaging Het
Tespa1 A T 10: 130,362,035 K309* probably null Het
Trim69 A G 2: 122,174,246 T275A probably benign Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Ugt2a2 A T 5: 87,474,892 F72L probably damaging Het
Vmn2r59 A T 7: 42,046,072 D305E possibly damaging Het
Vmn2r71 A G 7: 85,624,389 I804V probably benign Het
Zfy2 T C Y: 2,107,159 K492E possibly damaging Het
Zkscan1 A G 5: 138,100,920 H375R probably damaging Het
Other mutations in Ctps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Ctps APN 4 120552944 missense probably damaging 1.00
IGL00919:Ctps APN 4 120567348 missense probably benign 0.03
IGL01510:Ctps APN 4 120558844 missense probably damaging 0.98
IGL01686:Ctps APN 4 120553986 missense probably benign
IGL01897:Ctps APN 4 120567279 missense probably damaging 1.00
IGL02261:Ctps APN 4 120542579 missense possibly damaging 0.53
IGL02797:Ctps APN 4 120562824 missense probably benign 0.03
R0125:Ctps UTSW 4 120561525 splice site probably benign
R1053:Ctps UTSW 4 120543722 splice site probably null
R2087:Ctps UTSW 4 120562815 missense probably benign 0.12
R3736:Ctps UTSW 4 120543746 missense probably benign
R3928:Ctps UTSW 4 120541896 missense probably benign
R3929:Ctps UTSW 4 120541896 missense probably benign
R4193:Ctps UTSW 4 120548138 missense probably damaging 1.00
R4389:Ctps UTSW 4 120558790 missense probably damaging 1.00
R4853:Ctps UTSW 4 120554010 missense probably damaging 1.00
R5074:Ctps UTSW 4 120553973 missense probably damaging 1.00
R5566:Ctps UTSW 4 120554103 splice site probably null
R6235:Ctps UTSW 4 120558806 missense probably benign 0.42
R6828:Ctps UTSW 4 120548138 missense probably damaging 1.00
R7232:Ctps UTSW 4 120548124 missense probably damaging 1.00
R7487:Ctps UTSW 4 120558800 missense probably damaging 1.00
X0027:Ctps UTSW 4 120554093 missense probably damaging 1.00
X0062:Ctps UTSW 4 120542617 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGAGTCTTTGACCAATCCCAAC -3'
(R):5'- AGTCTCCTGATGGCATGGAC -3'

Sequencing Primer
(F):5'- GCTTAATCCCTAAAACTGACATTGTG -3'
(R):5'- GGCATGGACATTACACGTAACTGTC -3'
Posted On2016-06-15