Incidental Mutation 'R5045:Ugt2a2'
ID394313
Institutional Source Beutler Lab
Gene Symbol Ugt2a2
Ensembl Gene ENSMUSG00000029268
Gene NameUDP glucuronosyltransferase 2 family, polypeptide A2
Synonyms
MMRRC Submission 042635-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5045 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location87459490-87482260 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87474892 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 72 (F72L)
Ref Sequence ENSEMBL: ENSMUSP00000078740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079811] [ENSMUST00000144144] [ENSMUST00000147854] [ENSMUST00000201519]
Predicted Effect probably damaging
Transcript: ENSMUST00000079811
AA Change: F72L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078740
Gene: ENSMUSG00000029268
AA Change: F72L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:UDPGT 22 525 3.5e-233 PFAM
Pfam:Glyco_tran_28_C 332 453 1.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144144
SMART Domains Protein: ENSMUSP00000114842
Gene: ENSMUSG00000029268

DomainStartEndE-ValueType
Pfam:UDPGT 1 277 2.3e-168 PFAM
Pfam:Glyco_tran_28_C 100 203 7.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147854
SMART Domains Protein: ENSMUSP00000114583
Gene: ENSMUSG00000106677

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UDPGT 21 525 1.2e-235 PFAM
Pfam:Glyco_tran_28_C 332 453 1.4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201519
AA Change: F282L

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143986
Gene: ENSMUSG00000107180
AA Change: F282L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:UDPGT 21 240 2.3e-54 PFAM
Pfam:UDPGT 236 499 2.9e-75 PFAM
Pfam:UDPGT 498 691 2.6e-116 PFAM
Pfam:Glyco_tran_28_C 512 618 3.1e-6 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,476,178 probably benign Het
2210408I21Rik A G 13: 77,267,808 probably null Het
4930430A15Rik T A 2: 111,193,459 Q110L unknown Het
4930519P11Rik A T 2: 154,613,030 C136* probably null Het
4930519P11Rik G T 2: 154,613,062 probably benign Het
Adgrb3 T A 1: 25,074,779 H1189L probably damaging Het
Arhgap24 A G 5: 102,891,877 I227V possibly damaging Het
Arhgap29 C A 3: 122,002,595 N445K probably benign Het
Atp13a3 T C 16: 30,339,876 H811R probably benign Het
Cd2ap T C 17: 42,807,960 N529S probably benign Het
Cdh7 T A 1: 110,098,350 S439T probably benign Het
Ces3a G T 8: 105,050,616 probably null Het
Cftr T A 6: 18,230,081 N408K probably benign Het
Chil5 T C 3: 106,024,140 N136S possibly damaging Het
Col20a1 A G 2: 181,006,845 D933G probably damaging Het
Crh A T 3: 19,693,989 L163* probably null Het
Ctps A C 4: 120,552,878 probably null Het
Cyb5d2 A G 11: 72,795,575 V63A probably damaging Het
Cyp2d11 T A 15: 82,391,071 probably null Het
Dclk3 A T 9: 111,467,788 E133D probably damaging Het
Dhrs9 A G 2: 69,392,995 D29G probably benign Het
Disp2 G A 2: 118,792,062 E1092K probably benign Het
Enpp3 A G 10: 24,776,767 I764T probably damaging Het
Epm2aip1 C A 9: 111,273,359 R467S possibly damaging Het
Fam20a T C 11: 109,677,885 I272V probably benign Het
Fgb T C 3: 83,043,373 Y358C probably damaging Het
Gm11596 A T 11: 99,792,869 S142T unknown Het
Gm4858 G T 3: 93,074,217 D181Y probably damaging Het
Golga4 A G 9: 118,565,656 T9A probably benign Het
Hmcn2 C T 2: 31,409,081 P2813L probably damaging Het
Ighv1-9 C T 12: 114,583,820 G34R probably damaging Het
Kalrn A C 16: 34,314,352 Y353* probably null Het
Klrk1 T C 6: 129,617,503 Y42C probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mbtd1 T C 11: 93,931,815 Y484H probably benign Het
Mki67 T C 7: 135,707,904 R273G possibly damaging Het
Myh11 A T 16: 14,239,527 L308* probably null Het
Nacc2 G A 2: 26,090,138 probably null Het
Nadsyn1 A G 7: 143,806,969 L354P probably damaging Het
Ntrk3 T A 7: 78,460,424 Q354L probably benign Het
Olfr1124 A T 2: 87,435,146 I220L probably damaging Het
Olfr584 G A 7: 103,086,457 G308E probably benign Het
Phactr3 T C 2: 178,331,619 I470T probably damaging Het
Pkd1l3 C T 8: 109,623,155 P211S unknown Het
Prickle2 T C 6: 92,376,394 D753G probably damaging Het
Prr12 A G 7: 45,049,894 probably benign Het
Psd3 T C 8: 67,713,825 E917G probably damaging Het
Rgsl1 T A 1: 153,821,522 K551* probably null Het
Stag3 T C 5: 138,304,478 L1033P probably damaging Het
Tcaf3 T A 6: 42,593,684 Q378L possibly damaging Het
Tespa1 A T 10: 130,362,035 K309* probably null Het
Trim69 A G 2: 122,174,246 T275A probably benign Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Vmn2r59 A T 7: 42,046,072 D305E possibly damaging Het
Vmn2r71 A G 7: 85,624,389 I804V probably benign Het
Zfy2 T C Y: 2,107,159 K492E possibly damaging Het
Zkscan1 A G 5: 138,100,920 H375R probably damaging Het
Other mutations in Ugt2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0131:Ugt2a2 UTSW 5 87474861 nonsense probably null
R0132:Ugt2a2 UTSW 5 87474861 nonsense probably null
R0233:Ugt2a2 UTSW 5 87475001 missense probably damaging 1.00
R0390:Ugt2a2 UTSW 5 87464148 missense probably benign 0.38
R0732:Ugt2a2 UTSW 5 87460639 missense probably damaging 1.00
R0841:Ugt2a2 UTSW 5 87474789 missense probably benign 0.00
R1168:Ugt2a2 UTSW 5 87465568 splice site probably null
R1433:Ugt2a2 UTSW 5 87464106 missense probably damaging 0.98
R1552:Ugt2a2 UTSW 5 87462021 missense possibly damaging 0.90
R1795:Ugt2a2 UTSW 5 87474456 missense probably benign
R1986:Ugt2a2 UTSW 5 87460579 missense possibly damaging 0.66
R2967:Ugt2a2 UTSW 5 87474629 missense probably damaging 0.99
R3053:Ugt2a2 UTSW 5 87474469 missense probably damaging 1.00
R4641:Ugt2a2 UTSW 5 87462896 missense probably damaging 1.00
R5098:Ugt2a2 UTSW 5 87464181 missense possibly damaging 0.47
R5725:Ugt2a2 UTSW 5 87474896 missense probably damaging 0.98
R6243:Ugt2a2 UTSW 5 87462959 missense probably benign 0.13
R6502:Ugt2a2 UTSW 5 87460459 missense possibly damaging 0.80
R6650:Ugt2a2 UTSW 5 87474600 missense probably damaging 1.00
R7097:Ugt2a2 UTSW 5 87460396 missense possibly damaging 0.85
R7122:Ugt2a2 UTSW 5 87460396 missense possibly damaging 0.85
R7134:Ugt2a2 UTSW 5 87460576 missense probably benign 0.12
R7205:Ugt2a2 UTSW 5 87460609 missense possibly damaging 0.65
R7476:Ugt2a2 UTSW 5 87474494 missense probably damaging 1.00
R7498:Ugt2a2 UTSW 5 87474641 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGGTCAGCTAGTAACACATCG -3'
(R):5'- CTGAAATTGTTCTCAGCGGG -3'

Sequencing Primer
(F):5'- GGGATTGTTTAGTACACCATCACAC -3'
(R):5'- AAATTGTTCTCAGCGGGAATGTG -3'
Posted On2016-06-15