Incidental Mutation 'R5045:Cftr'
ID394317
Institutional Source Beutler Lab
Gene Symbol Cftr
Ensembl Gene ENSMUSG00000041301
Gene Namecystic fibrosis transmembrane conductance regulator
SynonymsAbcc7
MMRRC Submission 042635-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R5045 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location18170687-18322768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18230081 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 408 (N408K)
Ref Sequence ENSEMBL: ENSMUSP00000111065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045706] [ENSMUST00000115405] [ENSMUST00000115406] [ENSMUST00000129452] [ENSMUST00000140407]
Predicted Effect probably benign
Transcript: ENSMUST00000045706
AA Change: N438K

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049228
Gene: ENSMUSG00000041301
AA Change: N438K

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 3.7e-40 PFAM
AAA 450 623 2.16e-12 SMART
Pfam:CFTR_R 639 844 2e-93 PFAM
Pfam:ABC_membrane 857 1142 2.7e-53 PFAM
AAA 1232 1414 9.94e-12 SMART
low complexity region 1465 1474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115405
AA Change: N438K

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111064
Gene: ENSMUSG00000041301
AA Change: N438K

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 1.4e-48 PFAM
Pfam:ABC_tran 441 570 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115406
AA Change: N408K

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000111065
Gene: ENSMUSG00000041301
AA Change: N408K

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 167 4e-14 PFAM
Pfam:ABC_membrane 162 320 2.5e-20 PFAM
AAA 420 593 2.16e-12 SMART
Pfam:CFTR_R 609 815 1.3e-97 PFAM
Pfam:ABC_membrane 827 1112 1e-50 PFAM
AAA 1202 1384 9.94e-12 SMART
low complexity region 1435 1444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129452
AA Change: N438K

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000115334
Gene: ENSMUSG00000041301
AA Change: N438K

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 3.9e-39 PFAM
Pfam:ABC_tran 441 528 5.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140407
AA Change: N438K

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116957
Gene: ENSMUSG00000041301
AA Change: N438K

DomainStartEndE-ValueType
Pfam:ABC_membrane 81 350 1.2e-48 PFAM
Pfam:ABC_tran 441 568 6.3e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This gene encodes the cystic fibrosis transmembrane regulator and a chloride channel that controls the regulation of other transport pathways. Mutations in this gene have been associated with autosomal recessive disorders such as cystic fibrosis and congenital bilateral aplasia of the vas deferens. Alternative splicing of exons 4, 5, and 11 have been observed, but full-length transcripts have not yet been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit high mortality associated with intestinal obstruction, and altered mucous and serous glands. Mutants, like humans with cystic fibrosis, also exhibit defective epithelial chloride transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,476,178 probably benign Het
2210408I21Rik A G 13: 77,267,808 probably null Het
4930430A15Rik T A 2: 111,193,459 Q110L unknown Het
4930519P11Rik A T 2: 154,613,030 C136* probably null Het
4930519P11Rik G T 2: 154,613,062 probably benign Het
Adgrb3 T A 1: 25,074,779 H1189L probably damaging Het
Arhgap24 A G 5: 102,891,877 I227V possibly damaging Het
Arhgap29 C A 3: 122,002,595 N445K probably benign Het
Atp13a3 T C 16: 30,339,876 H811R probably benign Het
Cd2ap T C 17: 42,807,960 N529S probably benign Het
Cdh7 T A 1: 110,098,350 S439T probably benign Het
Ces3a G T 8: 105,050,616 probably null Het
Chil5 T C 3: 106,024,140 N136S possibly damaging Het
Col20a1 A G 2: 181,006,845 D933G probably damaging Het
Crh A T 3: 19,693,989 L163* probably null Het
Ctps A C 4: 120,552,878 probably null Het
Cyb5d2 A G 11: 72,795,575 V63A probably damaging Het
Cyp2d11 T A 15: 82,391,071 probably null Het
Dclk3 A T 9: 111,467,788 E133D probably damaging Het
Dhrs9 A G 2: 69,392,995 D29G probably benign Het
Disp2 G A 2: 118,792,062 E1092K probably benign Het
Enpp3 A G 10: 24,776,767 I764T probably damaging Het
Epm2aip1 C A 9: 111,273,359 R467S possibly damaging Het
Fam20a T C 11: 109,677,885 I272V probably benign Het
Fgb T C 3: 83,043,373 Y358C probably damaging Het
Gm11596 A T 11: 99,792,869 S142T unknown Het
Gm4858 G T 3: 93,074,217 D181Y probably damaging Het
Golga4 A G 9: 118,565,656 T9A probably benign Het
Hmcn2 C T 2: 31,409,081 P2813L probably damaging Het
Ighv1-9 C T 12: 114,583,820 G34R probably damaging Het
Kalrn A C 16: 34,314,352 Y353* probably null Het
Klrk1 T C 6: 129,617,503 Y42C probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mbtd1 T C 11: 93,931,815 Y484H probably benign Het
Mki67 T C 7: 135,707,904 R273G possibly damaging Het
Myh11 A T 16: 14,239,527 L308* probably null Het
Nacc2 G A 2: 26,090,138 probably null Het
Nadsyn1 A G 7: 143,806,969 L354P probably damaging Het
Ntrk3 T A 7: 78,460,424 Q354L probably benign Het
Olfr1124 A T 2: 87,435,146 I220L probably damaging Het
Olfr584 G A 7: 103,086,457 G308E probably benign Het
Phactr3 T C 2: 178,331,619 I470T probably damaging Het
Pkd1l3 C T 8: 109,623,155 P211S unknown Het
Prickle2 T C 6: 92,376,394 D753G probably damaging Het
Prr12 A G 7: 45,049,894 probably benign Het
Psd3 T C 8: 67,713,825 E917G probably damaging Het
Rgsl1 T A 1: 153,821,522 K551* probably null Het
Stag3 T C 5: 138,304,478 L1033P probably damaging Het
Tcaf3 T A 6: 42,593,684 Q378L possibly damaging Het
Tespa1 A T 10: 130,362,035 K309* probably null Het
Trim69 A G 2: 122,174,246 T275A probably benign Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Ugt2a2 A T 5: 87,474,892 F72L probably damaging Het
Vmn2r59 A T 7: 42,046,072 D305E possibly damaging Het
Vmn2r71 A G 7: 85,624,389 I804V probably benign Het
Zfy2 T C Y: 2,107,159 K492E possibly damaging Het
Zkscan1 A G 5: 138,100,920 H375R probably damaging Het
Other mutations in Cftr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Cftr APN 6 18268430 critical splice donor site probably null
IGL01082:Cftr APN 6 18226103 missense probably damaging 0.97
IGL01113:Cftr APN 6 18270253 missense probably damaging 1.00
IGL01383:Cftr APN 6 18226041 missense probably benign 0.00
IGL01595:Cftr APN 6 18198239 splice site probably benign
IGL01820:Cftr APN 6 18226139 missense probably damaging 1.00
IGL02223:Cftr APN 6 18221482 missense probably damaging 1.00
IGL02249:Cftr APN 6 18277871 missense possibly damaging 0.58
IGL02439:Cftr APN 6 18258238 nonsense probably null
IGL02537:Cftr APN 6 18274597 missense probably benign 0.31
IGL03234:Cftr APN 6 18225988 missense probably damaging 0.96
PIT4453001:Cftr UTSW 6 18214106 missense probably damaging 0.99
PIT4520001:Cftr UTSW 6 18277843 missense probably benign 0.01
R0114:Cftr UTSW 6 18282448 missense probably damaging 1.00
R0329:Cftr UTSW 6 18226097 missense probably null 1.00
R0330:Cftr UTSW 6 18226097 missense probably null 1.00
R0331:Cftr UTSW 6 18235226 missense possibly damaging 0.72
R0480:Cftr UTSW 6 18274518 splice site probably benign
R0612:Cftr UTSW 6 18198126 missense probably benign 0.01
R0633:Cftr UTSW 6 18305980 missense probably damaging 0.99
R0830:Cftr UTSW 6 18270225 missense probably benign 0.02
R1559:Cftr UTSW 6 18225937 missense probably benign 0.01
R1629:Cftr UTSW 6 18226106 missense probably damaging 1.00
R1636:Cftr UTSW 6 18226157 missense probably damaging 0.99
R1860:Cftr UTSW 6 18268289 missense probably benign 0.00
R2043:Cftr UTSW 6 18320935 missense probably benign
R2211:Cftr UTSW 6 18214280 missense probably null 0.13
R4737:Cftr UTSW 6 18299883 missense probably benign 0.19
R4793:Cftr UTSW 6 18226088 missense probably damaging 1.00
R4857:Cftr UTSW 6 18320975 missense possibly damaging 0.92
R4984:Cftr UTSW 6 18235199 missense possibly damaging 0.89
R4999:Cftr UTSW 6 18221614 missense probably benign 0.17
R5183:Cftr UTSW 6 18299833 missense probably damaging 0.99
R5197:Cftr UTSW 6 18255414 missense probably benign 0.00
R5288:Cftr UTSW 6 18226129 nonsense probably null
R5337:Cftr UTSW 6 18319059 missense probably damaging 1.00
R5549:Cftr UTSW 6 18227954 missense probably benign 0.00
R5596:Cftr UTSW 6 18268096 missense probably benign 0.00
R5651:Cftr UTSW 6 18255365 splice site probably null
R5660:Cftr UTSW 6 18313687 missense probably benign 0.22
R5941:Cftr UTSW 6 18313646 missense probably damaging 1.00
R6221:Cftr UTSW 6 18282501 missense probably benign 0.00
R6222:Cftr UTSW 6 18282501 missense probably benign 0.00
R6229:Cftr UTSW 6 18220684 missense probably damaging 1.00
R6256:Cftr UTSW 6 18274661 missense probably damaging 0.96
R6257:Cftr UTSW 6 18282501 missense probably benign 0.00
R6412:Cftr UTSW 6 18285604 missense probably damaging 0.97
R6459:Cftr UTSW 6 18258236 missense probably damaging 1.00
R6558:Cftr UTSW 6 18222528 missense probably damaging 1.00
R6724:Cftr UTSW 6 18255974 nonsense probably null
R6787:Cftr UTSW 6 18274608 nonsense probably null
R6861:Cftr UTSW 6 18268108 missense probably benign 0.00
R6888:Cftr UTSW 6 18313730 critical splice donor site probably null
R7084:Cftr UTSW 6 18226138 missense probably benign 0.17
R7105:Cftr UTSW 6 18318972 missense probably damaging 1.00
R7320:Cftr UTSW 6 18319013 missense probably damaging 0.97
R7359:Cftr UTSW 6 18221624 missense probably benign 0.00
R7466:Cftr UTSW 6 18227973 missense probably benign
R7502:Cftr UTSW 6 18214296 missense probably damaging 1.00
R7748:Cftr UTSW 6 18277889 critical splice donor site probably null
R7808:Cftr UTSW 6 18204205 missense probably benign
R7817:Cftr UTSW 6 18267968 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACTCTCCAGAAACCATGTGC -3'
(R):5'- TGAGTGATCAGTTCTAAACACGTG -3'

Sequencing Primer
(F):5'- CTCTCCAGAAACCATGTGCTTTATAG -3'
(R):5'- CTTGAATTTTAATGGAAGTGAGGAGG -3'
Posted On2016-06-15