Incidental Mutation 'R5045:Ntrk3'
ID394323
Institutional Source Beutler Lab
Gene Symbol Ntrk3
Ensembl Gene ENSMUSG00000059146
Gene Nameneurotrophic tyrosine kinase, receptor, type 3
SynonymsTrkC
MMRRC Submission 042635-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5045 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location78175959-78738012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78460424 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 354 (Q354L)
Ref Sequence ENSEMBL: ENSMUSP00000038324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039431] [ENSMUST00000039438] [ENSMUST00000193002] [ENSMUST00000195262]
Predicted Effect probably benign
Transcript: ENSMUST00000039431
AA Change: Q354L

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000037909
Gene: ENSMUSG00000059146
AA Change: Q354L

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 2.4e-8 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 810 1.49e-145 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039438
AA Change: Q354L

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038324
Gene: ENSMUSG00000059146
AA Change: Q354L

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 3.1e-8 PFAM
transmembrane domain 429 451 N/A INTRINSIC
PDB:2MFQ|B 497 517 2e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155795
Predicted Effect probably benign
Transcript: ENSMUST00000193002
AA Change: Q354L

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141534
Gene: ENSMUSG00000059146
AA Change: Q354L

DomainStartEndE-ValueType
LRRNT 31 63 2.46e-4 SMART
LRRCT 160 208 3.58e-12 SMART
IG 216 302 1.24e-8 SMART
Pfam:I-set 308 392 2.4e-8 PFAM
Pfam:Ig_2 312 392 6.9e-4 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 824 4.29e-137 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195262
AA Change: Q354L

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141599
Gene: ENSMUSG00000059146
AA Change: Q354L

DomainStartEndE-ValueType
LRRNT 31 63 1.2e-6 SMART
LRRCT 160 208 1.8e-14 SMART
IG 216 302 5.1e-11 SMART
Pfam:I-set 308 392 4.7e-7 PFAM
Pfam:Ig_2 312 392 1.3e-2 PFAM
transmembrane domain 430 452 N/A INTRINSIC
TyrKc 538 849 9.7e-132 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in this gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted mutations show a range of phenotypes including postnatal death at 2-21 days, cardiac defects, reduced numbers of dorsal root ganglia neurons and germ cells, abnormal motor coordination and posture and abnormal sensory innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,476,178 probably benign Het
2210408I21Rik A G 13: 77,267,808 probably null Het
4930430A15Rik T A 2: 111,193,459 Q110L unknown Het
4930519P11Rik A T 2: 154,613,030 C136* probably null Het
4930519P11Rik G T 2: 154,613,062 probably benign Het
Adgrb3 T A 1: 25,074,779 H1189L probably damaging Het
Arhgap24 A G 5: 102,891,877 I227V possibly damaging Het
Arhgap29 C A 3: 122,002,595 N445K probably benign Het
Atp13a3 T C 16: 30,339,876 H811R probably benign Het
Cd2ap T C 17: 42,807,960 N529S probably benign Het
Cdh7 T A 1: 110,098,350 S439T probably benign Het
Ces3a G T 8: 105,050,616 probably null Het
Cftr T A 6: 18,230,081 N408K probably benign Het
Chil5 T C 3: 106,024,140 N136S possibly damaging Het
Col20a1 A G 2: 181,006,845 D933G probably damaging Het
Crh A T 3: 19,693,989 L163* probably null Het
Ctps A C 4: 120,552,878 probably null Het
Cyb5d2 A G 11: 72,795,575 V63A probably damaging Het
Cyp2d11 T A 15: 82,391,071 probably null Het
Dclk3 A T 9: 111,467,788 E133D probably damaging Het
Dhrs9 A G 2: 69,392,995 D29G probably benign Het
Disp2 G A 2: 118,792,062 E1092K probably benign Het
Enpp3 A G 10: 24,776,767 I764T probably damaging Het
Epm2aip1 C A 9: 111,273,359 R467S possibly damaging Het
Fam20a T C 11: 109,677,885 I272V probably benign Het
Fgb T C 3: 83,043,373 Y358C probably damaging Het
Gm11596 A T 11: 99,792,869 S142T unknown Het
Gm4858 G T 3: 93,074,217 D181Y probably damaging Het
Golga4 A G 9: 118,565,656 T9A probably benign Het
Hmcn2 C T 2: 31,409,081 P2813L probably damaging Het
Ighv1-9 C T 12: 114,583,820 G34R probably damaging Het
Kalrn A C 16: 34,314,352 Y353* probably null Het
Klrk1 T C 6: 129,617,503 Y42C probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mbtd1 T C 11: 93,931,815 Y484H probably benign Het
Mki67 T C 7: 135,707,904 R273G possibly damaging Het
Myh11 A T 16: 14,239,527 L308* probably null Het
Nacc2 G A 2: 26,090,138 probably null Het
Nadsyn1 A G 7: 143,806,969 L354P probably damaging Het
Olfr1124 A T 2: 87,435,146 I220L probably damaging Het
Olfr584 G A 7: 103,086,457 G308E probably benign Het
Phactr3 T C 2: 178,331,619 I470T probably damaging Het
Pkd1l3 C T 8: 109,623,155 P211S unknown Het
Prickle2 T C 6: 92,376,394 D753G probably damaging Het
Prr12 A G 7: 45,049,894 probably benign Het
Psd3 T C 8: 67,713,825 E917G probably damaging Het
Rgsl1 T A 1: 153,821,522 K551* probably null Het
Stag3 T C 5: 138,304,478 L1033P probably damaging Het
Tcaf3 T A 6: 42,593,684 Q378L possibly damaging Het
Tespa1 A T 10: 130,362,035 K309* probably null Het
Trim69 A G 2: 122,174,246 T275A probably benign Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Ugt2a2 A T 5: 87,474,892 F72L probably damaging Het
Vmn2r59 A T 7: 42,046,072 D305E possibly damaging Het
Vmn2r71 A G 7: 85,624,389 I804V probably benign Het
Zfy2 T C Y: 2,107,159 K492E possibly damaging Het
Zkscan1 A G 5: 138,100,920 H375R probably damaging Het
Other mutations in Ntrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Ntrk3 APN 7 78250873 missense probably benign 0.03
IGL00862:Ntrk3 APN 7 78247177 missense probably damaging 1.00
IGL00972:Ntrk3 APN 7 78247322 missense possibly damaging 0.95
IGL00976:Ntrk3 APN 7 78450953 missense probably benign 0.02
IGL02172:Ntrk3 APN 7 78460272 splice site probably benign
IGL02175:Ntrk3 APN 7 78247228 missense probably damaging 1.00
IGL02213:Ntrk3 APN 7 78462931 missense probably benign 0.17
IGL02363:Ntrk3 APN 7 78453337 missense probably benign 0.24
IGL02527:Ntrk3 APN 7 78451949 missense probably benign
IGL02673:Ntrk3 APN 7 78250764 missense probably damaging 1.00
IGL02755:Ntrk3 APN 7 78460439 missense probably benign
IGL02998:Ntrk3 APN 7 78577657 missense probably damaging 0.98
IGL03235:Ntrk3 APN 7 78192592 missense probably damaging 1.00
R1465:Ntrk3 UTSW 7 78356014 splice site probably benign
R1505:Ntrk3 UTSW 7 78460524 missense probably damaging 0.99
R1638:Ntrk3 UTSW 7 78247288 missense probably damaging 1.00
R1641:Ntrk3 UTSW 7 78356074 missense probably damaging 1.00
R1775:Ntrk3 UTSW 7 78356041 missense possibly damaging 0.60
R1786:Ntrk3 UTSW 7 78477935 splice site probably benign
R1827:Ntrk3 UTSW 7 78247301 missense probably damaging 1.00
R1868:Ntrk3 UTSW 7 78192604 missense possibly damaging 0.90
R1873:Ntrk3 UTSW 7 78462839 missense probably benign
R1929:Ntrk3 UTSW 7 78516723 splice site probably null
R1941:Ntrk3 UTSW 7 78247262 missense probably damaging 1.00
R2132:Ntrk3 UTSW 7 78477935 splice site probably benign
R2214:Ntrk3 UTSW 7 78516772 missense probably damaging 1.00
R2221:Ntrk3 UTSW 7 78198852 missense probably damaging 1.00
R2223:Ntrk3 UTSW 7 78198852 missense probably damaging 1.00
R2271:Ntrk3 UTSW 7 78516723 splice site probably null
R2441:Ntrk3 UTSW 7 78302662 missense probably damaging 1.00
R3108:Ntrk3 UTSW 7 78460515 missense probably benign 0.01
R3109:Ntrk3 UTSW 7 78460515 missense probably benign 0.01
R3959:Ntrk3 UTSW 7 78198842 missense probably damaging 1.00
R4016:Ntrk3 UTSW 7 78462947 splice site probably benign
R4028:Ntrk3 UTSW 7 78192710 missense probably damaging 1.00
R4067:Ntrk3 UTSW 7 78517437 missense probably damaging 1.00
R4398:Ntrk3 UTSW 7 78250769 nonsense probably null
R4664:Ntrk3 UTSW 7 78461099 missense probably damaging 0.99
R5081:Ntrk3 UTSW 7 78577774 missense probably damaging 0.99
R5151:Ntrk3 UTSW 7 78247300 missense probably damaging 1.00
R5249:Ntrk3 UTSW 7 78461166 missense possibly damaging 0.87
R5294:Ntrk3 UTSW 7 78517506 splice site probably null
R5594:Ntrk3 UTSW 7 78451899 missense probably benign 0.10
R5923:Ntrk3 UTSW 7 78451928 missense possibly damaging 0.61
R6878:Ntrk3 UTSW 7 78304372 missense probably benign 0.00
R7083:Ntrk3 UTSW 7 78250839 missense probably damaging 1.00
R7178:Ntrk3 UTSW 7 78356147 missense possibly damaging 0.86
R7487:Ntrk3 UTSW 7 78250713 missense probably damaging 1.00
R7607:Ntrk3 UTSW 7 78250873 missense probably benign 0.03
R7800:Ntrk3 UTSW 7 78302740 missense probably benign 0.09
R8009:Ntrk3 UTSW 7 78453328
R8032:Ntrk3 UTSW 7 78356059
Predicted Primers PCR Primer
(F):5'- CAGTGCCGTTGATTCTTTCAAAC -3'
(R):5'- TGTGTCCTCGAGATCAGCTTG -3'

Sequencing Primer
(F):5'- GTCCCCCAGCTTCCAGAAGAG -3'
(R):5'- CGAGATCAGCTTGCTTTTCC -3'
Posted On2016-06-15