Incidental Mutation 'R5045:Nadsyn1'
ID394331
Institutional Source Beutler Lab
Gene Symbol Nadsyn1
Ensembl Gene ENSMUSG00000031090
Gene NameNAD synthetase 1
Synonyms9130012B15Rik
MMRRC Submission 042635-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5045 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location143795584-143822849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143806969 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 354 (L354P)
Ref Sequence ENSEMBL: ENSMUSP00000114380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033415] [ENSMUST00000132520] [ENSMUST00000156638]
Predicted Effect probably damaging
Transcript: ENSMUST00000033415
AA Change: L354P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033415
Gene: ENSMUSG00000031090
AA Change: L354P

DomainStartEndE-ValueType
Pfam:CN_hydrolase 6 283 3.2e-52 PFAM
Pfam:NAD_synthase 337 649 3.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132520
AA Change: L354P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114380
Gene: ENSMUSG00000031090
AA Change: L354P

DomainStartEndE-ValueType
Pfam:CN_hydrolase 6 201 6.3e-39 PFAM
Pfam:NAD_synthase 336 561 8.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156638
SMART Domains Protein: ENSMUSP00000114889
Gene: ENSMUSG00000031090

DomainStartEndE-ValueType
SCOP:d1f89a_ 1 28 1e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nicotinamide adenine dinucleotide (NAD) is a coenzyme in metabolic redox reactions, a precursor for several cell signaling molecules, and a substrate for protein posttranslational modifications. NAD synthetase (EC 6.3.5.1) catalyzes the final step in the biosynthesis of NAD from nicotinic acid adenine dinucleotide (NaAD).[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,476,178 probably benign Het
2210408I21Rik A G 13: 77,267,808 probably null Het
4930430A15Rik T A 2: 111,193,459 Q110L unknown Het
4930519P11Rik A T 2: 154,613,030 C136* probably null Het
4930519P11Rik G T 2: 154,613,062 probably benign Het
Adgrb3 T A 1: 25,074,779 H1189L probably damaging Het
Arhgap24 A G 5: 102,891,877 I227V possibly damaging Het
Arhgap29 C A 3: 122,002,595 N445K probably benign Het
Atp13a3 T C 16: 30,339,876 H811R probably benign Het
Cd2ap T C 17: 42,807,960 N529S probably benign Het
Cdh7 T A 1: 110,098,350 S439T probably benign Het
Ces3a G T 8: 105,050,616 probably null Het
Cftr T A 6: 18,230,081 N408K probably benign Het
Chil5 T C 3: 106,024,140 N136S possibly damaging Het
Col20a1 A G 2: 181,006,845 D933G probably damaging Het
Crh A T 3: 19,693,989 L163* probably null Het
Ctps A C 4: 120,552,878 probably null Het
Cyb5d2 A G 11: 72,795,575 V63A probably damaging Het
Cyp2d11 T A 15: 82,391,071 probably null Het
Dclk3 A T 9: 111,467,788 E133D probably damaging Het
Dhrs9 A G 2: 69,392,995 D29G probably benign Het
Disp2 G A 2: 118,792,062 E1092K probably benign Het
Enpp3 A G 10: 24,776,767 I764T probably damaging Het
Epm2aip1 C A 9: 111,273,359 R467S possibly damaging Het
Fam20a T C 11: 109,677,885 I272V probably benign Het
Fgb T C 3: 83,043,373 Y358C probably damaging Het
Gm11596 A T 11: 99,792,869 S142T unknown Het
Gm4858 G T 3: 93,074,217 D181Y probably damaging Het
Golga4 A G 9: 118,565,656 T9A probably benign Het
Hmcn2 C T 2: 31,409,081 P2813L probably damaging Het
Ighv1-9 C T 12: 114,583,820 G34R probably damaging Het
Kalrn A C 16: 34,314,352 Y353* probably null Het
Klrk1 T C 6: 129,617,503 Y42C probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mbtd1 T C 11: 93,931,815 Y484H probably benign Het
Mki67 T C 7: 135,707,904 R273G possibly damaging Het
Myh11 A T 16: 14,239,527 L308* probably null Het
Nacc2 G A 2: 26,090,138 probably null Het
Ntrk3 T A 7: 78,460,424 Q354L probably benign Het
Olfr1124 A T 2: 87,435,146 I220L probably damaging Het
Olfr584 G A 7: 103,086,457 G308E probably benign Het
Phactr3 T C 2: 178,331,619 I470T probably damaging Het
Pkd1l3 C T 8: 109,623,155 P211S unknown Het
Prickle2 T C 6: 92,376,394 D753G probably damaging Het
Prr12 A G 7: 45,049,894 probably benign Het
Psd3 T C 8: 67,713,825 E917G probably damaging Het
Rgsl1 T A 1: 153,821,522 K551* probably null Het
Stag3 T C 5: 138,304,478 L1033P probably damaging Het
Tcaf3 T A 6: 42,593,684 Q378L possibly damaging Het
Tespa1 A T 10: 130,362,035 K309* probably null Het
Trim69 A G 2: 122,174,246 T275A probably benign Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Ugt2a2 A T 5: 87,474,892 F72L probably damaging Het
Vmn2r59 A T 7: 42,046,072 D305E possibly damaging Het
Vmn2r71 A G 7: 85,624,389 I804V probably benign Het
Zfy2 T C Y: 2,107,159 K492E possibly damaging Het
Zkscan1 A G 5: 138,100,920 H375R probably damaging Het
Other mutations in Nadsyn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Nadsyn1 APN 7 143812793 missense probably damaging 1.00
IGL01359:Nadsyn1 APN 7 143821230 missense possibly damaging 0.74
IGL01412:Nadsyn1 APN 7 143808790 critical splice donor site probably null
IGL01481:Nadsyn1 APN 7 143812584 missense probably damaging 1.00
IGL01642:Nadsyn1 APN 7 143797878 missense probably damaging 1.00
IGL02110:Nadsyn1 APN 7 143813427 missense probably damaging 1.00
IGL02126:Nadsyn1 APN 7 143804016 nonsense probably null
IGL02173:Nadsyn1 APN 7 143804006 splice site probably benign
IGL02351:Nadsyn1 APN 7 143799912 missense probably damaging 1.00
IGL02358:Nadsyn1 APN 7 143799912 missense probably damaging 1.00
IGL03216:Nadsyn1 APN 7 143797845 missense probably damaging 1.00
R0029:Nadsyn1 UTSW 7 143806078 missense probably benign 0.01
R0036:Nadsyn1 UTSW 7 143811291 missense probably benign 0.23
R0968:Nadsyn1 UTSW 7 143806033 missense probably benign 0.30
R1487:Nadsyn1 UTSW 7 143806925 missense probably benign 0.31
R1694:Nadsyn1 UTSW 7 143808012 missense probably benign 0.00
R1874:Nadsyn1 UTSW 7 143797844 missense probably damaging 1.00
R4540:Nadsyn1 UTSW 7 143803223 missense probably damaging 1.00
R4742:Nadsyn1 UTSW 7 143798630 intron probably benign
R4755:Nadsyn1 UTSW 7 143806913 missense probably damaging 1.00
R5288:Nadsyn1 UTSW 7 143803286 missense possibly damaging 0.95
R5326:Nadsyn1 UTSW 7 143808830 missense probably benign 0.42
R5666:Nadsyn1 UTSW 7 143807431 missense probably damaging 1.00
R5669:Nadsyn1 UTSW 7 143807431 missense probably damaging 1.00
R5691:Nadsyn1 UTSW 7 143812579 unclassified probably null
R5861:Nadsyn1 UTSW 7 143811227 missense possibly damaging 0.80
R6213:Nadsyn1 UTSW 7 143799812 missense probably benign 0.05
R6624:Nadsyn1 UTSW 7 143805973 missense probably benign 0.02
R6652:Nadsyn1 UTSW 7 143811218 missense probably benign 0.03
R6791:Nadsyn1 UTSW 7 143819108 missense probably damaging 1.00
R7144:Nadsyn1 UTSW 7 143811215 missense probably damaging 0.99
R7559:Nadsyn1 UTSW 7 143808067 missense probably benign 0.00
R7770:Nadsyn1 UTSW 7 143806003 missense probably damaging 1.00
R7802:Nadsyn1 UTSW 7 143806026 missense probably benign
R7871:Nadsyn1 UTSW 7 143798496 nonsense probably null
R7954:Nadsyn1 UTSW 7 143798496 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGTAGGACAGGTGACATCTG -3'
(R):5'- GAAACCTCAGTCAGTCACGTG -3'

Sequencing Primer
(F):5'- GTGACATCTGTCCCCAGCAATG -3'
(R):5'- GTCATTTGTCCACCTCAGGGATG -3'
Posted On2016-06-15