Incidental Mutation 'R5045:Atp13a3'
ID394351
Institutional Source Beutler Lab
Gene Symbol Atp13a3
Ensembl Gene ENSMUSG00000022533
Gene NameATPase type 13A3
SynonymsLOC224088, LOC385637, LOC224087
MMRRC Submission 042635-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.501) question?
Stock #R5045 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location30312423-30405975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30339876 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 811 (H811R)
Ref Sequence ENSEMBL: ENSMUSP00000128224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061350] [ENSMUST00000100013]
Predicted Effect probably benign
Transcript: ENSMUST00000061350
AA Change: H811R

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000051645
Gene: ENSMUSG00000022533
AA Change: H811R

DomainStartEndE-ValueType
Pfam:P5-ATPase 13 139 4.9e-30 PFAM
Cation_ATPase_N 154 227 7.24e0 SMART
Pfam:E1-E2_ATPase 232 483 5.1e-36 PFAM
Pfam:HAD 491 888 7.5e-28 PFAM
Pfam:Hydrolase_like2 607 661 6.8e-8 PFAM
Pfam:Hydrolase 612 790 6.5e-11 PFAM
transmembrane domain 931 953 N/A INTRINSIC
transmembrane domain 963 985 N/A INTRINSIC
transmembrane domain 997 1019 N/A INTRINSIC
transmembrane domain 1068 1085 N/A INTRINSIC
transmembrane domain 1098 1120 N/A INTRINSIC
transmembrane domain 1135 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100013
AA Change: H811R

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128224
Gene: ENSMUSG00000022533
AA Change: H811R

DomainStartEndE-ValueType
Pfam:P5-ATPase 13 146 2.9e-38 PFAM
Cation_ATPase_N 154 227 7.24e0 SMART
Pfam:E1-E2_ATPase 232 483 7.3e-41 PFAM
Pfam:Hydrolase 488 784 1.3e-12 PFAM
Pfam:HAD 491 888 1.3e-31 PFAM
Pfam:Cation_ATPase 612 660 4.5e-7 PFAM
transmembrane domain 931 953 N/A INTRINSIC
transmembrane domain 963 985 N/A INTRINSIC
transmembrane domain 997 1019 N/A INTRINSIC
transmembrane domain 1068 1085 N/A INTRINSIC
transmembrane domain 1098 1120 N/A INTRINSIC
transmembrane domain 1135 1157 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATP13A3 is a member of the P-type ATPase family of proteins that transport a variety of cations across membranes. Other P-type ATPases include ATP7B (MIM 606882) and ATP7A (MIM 300011).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,476,178 probably benign Het
2210408I21Rik A G 13: 77,267,808 probably null Het
4930430A15Rik T A 2: 111,193,459 Q110L unknown Het
4930519P11Rik A T 2: 154,613,030 C136* probably null Het
4930519P11Rik G T 2: 154,613,062 probably benign Het
Adgrb3 T A 1: 25,074,779 H1189L probably damaging Het
Arhgap24 A G 5: 102,891,877 I227V possibly damaging Het
Arhgap29 C A 3: 122,002,595 N445K probably benign Het
Cd2ap T C 17: 42,807,960 N529S probably benign Het
Cdh7 T A 1: 110,098,350 S439T probably benign Het
Ces3a G T 8: 105,050,616 probably null Het
Cftr T A 6: 18,230,081 N408K probably benign Het
Chil5 T C 3: 106,024,140 N136S possibly damaging Het
Col20a1 A G 2: 181,006,845 D933G probably damaging Het
Crh A T 3: 19,693,989 L163* probably null Het
Ctps A C 4: 120,552,878 probably null Het
Cyb5d2 A G 11: 72,795,575 V63A probably damaging Het
Cyp2d11 T A 15: 82,391,071 probably null Het
Dclk3 A T 9: 111,467,788 E133D probably damaging Het
Dhrs9 A G 2: 69,392,995 D29G probably benign Het
Disp2 G A 2: 118,792,062 E1092K probably benign Het
Enpp3 A G 10: 24,776,767 I764T probably damaging Het
Epm2aip1 C A 9: 111,273,359 R467S possibly damaging Het
Fam20a T C 11: 109,677,885 I272V probably benign Het
Fgb T C 3: 83,043,373 Y358C probably damaging Het
Gm11596 A T 11: 99,792,869 S142T unknown Het
Gm4858 G T 3: 93,074,217 D181Y probably damaging Het
Golga4 A G 9: 118,565,656 T9A probably benign Het
Hmcn2 C T 2: 31,409,081 P2813L probably damaging Het
Ighv1-9 C T 12: 114,583,820 G34R probably damaging Het
Kalrn A C 16: 34,314,352 Y353* probably null Het
Klrk1 T C 6: 129,617,503 Y42C probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mbtd1 T C 11: 93,931,815 Y484H probably benign Het
Mki67 T C 7: 135,707,904 R273G possibly damaging Het
Myh11 A T 16: 14,239,527 L308* probably null Het
Nacc2 G A 2: 26,090,138 probably null Het
Nadsyn1 A G 7: 143,806,969 L354P probably damaging Het
Ntrk3 T A 7: 78,460,424 Q354L probably benign Het
Olfr1124 A T 2: 87,435,146 I220L probably damaging Het
Olfr584 G A 7: 103,086,457 G308E probably benign Het
Phactr3 T C 2: 178,331,619 I470T probably damaging Het
Pkd1l3 C T 8: 109,623,155 P211S unknown Het
Prickle2 T C 6: 92,376,394 D753G probably damaging Het
Prr12 A G 7: 45,049,894 probably benign Het
Psd3 T C 8: 67,713,825 E917G probably damaging Het
Rgsl1 T A 1: 153,821,522 K551* probably null Het
Stag3 T C 5: 138,304,478 L1033P probably damaging Het
Tcaf3 T A 6: 42,593,684 Q378L possibly damaging Het
Tespa1 A T 10: 130,362,035 K309* probably null Het
Trim69 A G 2: 122,174,246 T275A probably benign Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Ugt2a2 A T 5: 87,474,892 F72L probably damaging Het
Vmn2r59 A T 7: 42,046,072 D305E possibly damaging Het
Vmn2r71 A G 7: 85,624,389 I804V probably benign Het
Zfy2 T C Y: 2,107,159 K492E possibly damaging Het
Zkscan1 A G 5: 138,100,920 H375R probably damaging Het
Other mutations in Atp13a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Atp13a3 APN 16 30351279 missense probably damaging 0.99
IGL00490:Atp13a3 APN 16 30352354 missense probably benign 0.31
IGL01844:Atp13a3 APN 16 30361963 missense probably benign 0.17
IGL01994:Atp13a3 APN 16 30337518 missense possibly damaging 0.90
IGL02057:Atp13a3 APN 16 30332364 missense probably benign
IGL02083:Atp13a3 APN 16 30347706 missense possibly damaging 0.89
IGL02348:Atp13a3 APN 16 30351228 critical splice donor site probably null
IGL02352:Atp13a3 APN 16 30351084 missense probably damaging 1.00
IGL02359:Atp13a3 APN 16 30351084 missense probably damaging 1.00
IGL02643:Atp13a3 APN 16 30333796 missense probably null
IGL02687:Atp13a3 APN 16 30337551 missense probably damaging 1.00
IGL02951:Atp13a3 APN 16 30338621 splice site probably null
IGL03190:Atp13a3 APN 16 30322948 missense probably benign 0.00
H8562:Atp13a3 UTSW 16 30359725 nonsense probably null
H8786:Atp13a3 UTSW 16 30359725 nonsense probably null
PIT4812001:Atp13a3 UTSW 16 30362578 missense probably damaging 0.98
R0725:Atp13a3 UTSW 16 30351387 missense probably damaging 1.00
R1208:Atp13a3 UTSW 16 30354247 missense probably benign 0.21
R1208:Atp13a3 UTSW 16 30354247 missense probably benign 0.21
R1244:Atp13a3 UTSW 16 30361836 missense probably benign 0.00
R1326:Atp13a3 UTSW 16 30352310 missense probably damaging 1.00
R1613:Atp13a3 UTSW 16 30332300 missense probably damaging 1.00
R1672:Atp13a3 UTSW 16 30332274 missense possibly damaging 0.96
R1709:Atp13a3 UTSW 16 30315841 missense probably benign 0.37
R1733:Atp13a3 UTSW 16 30357266 missense probably benign 0.35
R2086:Atp13a3 UTSW 16 30352298 missense possibly damaging 0.89
R2128:Atp13a3 UTSW 16 30354276 missense probably damaging 0.97
R2421:Atp13a3 UTSW 16 30349825 missense probably benign 0.29
R3427:Atp13a3 UTSW 16 30344593 missense probably benign 0.05
R3783:Atp13a3 UTSW 16 30354249 missense probably damaging 1.00
R4058:Atp13a3 UTSW 16 30354246 missense possibly damaging 0.94
R4059:Atp13a3 UTSW 16 30354246 missense possibly damaging 0.94
R4798:Atp13a3 UTSW 16 30341240 missense probably damaging 1.00
R5216:Atp13a3 UTSW 16 30340284 missense probably damaging 1.00
R5704:Atp13a3 UTSW 16 30321879 missense probably benign 0.18
R5876:Atp13a3 UTSW 16 30362734 missense probably benign 0.13
R5947:Atp13a3 UTSW 16 30362700 missense probably benign 0.01
R6291:Atp13a3 UTSW 16 30336243 missense probably damaging 0.99
R6324:Atp13a3 UTSW 16 30332285 missense possibly damaging 0.72
R6328:Atp13a3 UTSW 16 30336235 missense probably damaging 0.99
R6372:Atp13a3 UTSW 16 30343455 missense probably damaging 0.99
R6446:Atp13a3 UTSW 16 30361869 missense probably benign 0.00
R7016:Atp13a3 UTSW 16 30338490 missense possibly damaging 0.54
R7086:Atp13a3 UTSW 16 30351063 missense possibly damaging 0.87
R7241:Atp13a3 UTSW 16 30352277 missense possibly damaging 0.93
R7589:Atp13a3 UTSW 16 30344615 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTGCCATTCGAGCAAACACAG -3'
(R):5'- ACTATCATTCCAGAGACTCTCACTC -3'

Sequencing Primer
(F):5'- TTCGAGCAAACACAGTACCATG -3'
(R):5'- ATTCCAGAGACTCTCACTCATTATTG -3'
Posted On2016-06-15