Mutagenetix > Incidental Mutation

Incidental Mutation 'R5045:Kalrn'

394352

Institutional Source

Beutler Lab

Gene Symbol

Kalrn

Ensembl Gene

ENSMUSG00000061751

Gene Name

kalirin, RhoGEF kinase

Synonyms

2210407G14Rik, Hapip, E530005C20Rik, LOC224126

MMRRC Submission

042635-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.922) question?

Stock #

R5045 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33969073-34573532 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to C at 34314352 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 353 (Y353*)

Ref Sequence

ENSEMBL: ENSMUSP00000123416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114960] [ENSMUST00000114961] [ENSMUST00000151491]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000076810
AA Change: Y347*

SMART Domains

Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: Y347*

Domain	Start	End	E-Value	Type
SEC14	20	159	2.22e-30	SMART
SPEC	173	289	5.32e-9	SMART
SPEC	295	397	1.19e-11	SMART
SPEC	400	515	1.83e0	SMART
SPEC	521	623	9.84e-13	SMART
SPEC	626	748	2.74e-2	SMART
SPEC	875	976	8.11e-14	SMART
SPEC	1106	1208	4.7e-10	SMART
RhoGEF	1258	1428	3.6e-56	SMART
PH	1442	1555	5.24e-8	SMART
SH3	1622	1683	1.23e-7	SMART
RhoGEF	1904	2074	1.47e-52	SMART
PH	2094	2199	9.87e-4	SMART
SH3	2295	2356	2.78e-2	SMART
IGc2	2455	2527	4.28e-12	SMART
FN3	2541	2623	3.07e-11	SMART
S_TKc	2656	2910	1.28e-71	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000089655
AA Change: Y365*

SMART Domains

Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751
AA Change: Y365*

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	1003	1.85e-8	SMART
SPEC	1133	1235	4.7e-10	SMART
RhoGEF	1285	1455	3.6e-56	SMART
PH	1469	1582	5.24e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000114960
AA Change: Y365*

SMART Domains

Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751
AA Change: Y365*

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	994	8.11e-14	SMART
SPEC	1124	1226	4.7e-10	SMART
RhoGEF	1276	1446	3.6e-56	SMART
PH	1460	1573	5.24e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114961

SMART Domains

Protein: ENSMUSP00000110612
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SEC14	40	179	2.22e-30	SMART
SPEC	193	309	5.32e-9	SMART
SPEC	315	417	1.19e-11	SMART
SPEC	420	535	1.83e0	SMART
SPEC	541	643	9.84e-13	SMART
SPEC	646	768	2.74e-2	SMART
SPEC	895	996	8.11e-14	SMART
SPEC	1126	1228	4.7e-10	SMART
RhoGEF	1278	1448	3.6e-56	SMART
PH	1462	1575	5.24e-8	SMART
SH3	1642	1703	1.23e-7	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000142817
AA Change: Y342*

SMART Domains

Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: Y342*

Domain	Start	End	E-Value	Type
SEC14	16	155	2.22e-30	SMART
SPEC	169	285	5.32e-9	SMART
SPEC	291	393	1.19e-11	SMART
SPEC	396	511	1.83e0	SMART
SPEC	517	619	9.84e-13	SMART
SPEC	622	744	2.74e-2	SMART
SPEC	871	972	8.11e-14	SMART
SPEC	1102	1204	4.7e-10	SMART
RhoGEF	1254	1424	3.6e-56	SMART
PH	1438	1551	5.24e-8	SMART
SH3	1618	1679	1.23e-7	SMART
RhoGEF	1900	2070	1.47e-52	SMART
PH	2090	2195	9.87e-4	SMART
SH3	2291	2352	2.78e-2	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000151491
AA Change: Y353*

SMART Domains

Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751
AA Change: Y353*

Domain	Start	End	E-Value	Type
SEC14	26	165	2.22e-30	SMART
SPEC	179	295	5.32e-9	SMART
SPEC	301	403	1.19e-11	SMART
SPEC	640	750	1.85e-8	SMART
SPEC	880	982	4.7e-10	SMART
RhoGEF	1032	1202	3.6e-56	SMART
PH	1216	1329	5.24e-8	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810062G17Rik	T	C	3: 36,476,178 (GRCm38)		probably benign	Het
2210408I21Rik	A	G	13: 77,267,808 (GRCm38)		probably null	Het
4930430A15Rik	T	A	2: 111,193,459 (GRCm38)	Q110L	unknown	Het
4930519P11Rik	A	T	2: 154,613,030 (GRCm38)	C136*	probably null	Het
4930519P11Rik	G	T	2: 154,613,062 (GRCm38)		probably benign	Het
Adgrb3	T	A	1: 25,074,779 (GRCm38)	H1189L	probably damaging	Het
Arhgap24	A	G	5: 102,891,877 (GRCm38)	I227V	possibly damaging	Het
Arhgap29	C	A	3: 122,002,595 (GRCm38)	N445K	probably benign	Het
Atp13a3	T	C	16: 30,339,876 (GRCm38)	H811R	probably benign	Het
Cd2ap	T	C	17: 42,807,960 (GRCm38)	N529S	probably benign	Het
Cdh7	T	A	1: 110,098,350 (GRCm38)	S439T	probably benign	Het
Ces3a	G	T	8: 105,050,616 (GRCm38)		probably null	Het
Cftr	T	A	6: 18,230,081 (GRCm38)	N408K	probably benign	Het
Chil5	T	C	3: 106,024,140 (GRCm38)	N136S	possibly damaging	Het
Col20a1	A	G	2: 181,006,845 (GRCm38)	D933G	probably damaging	Het
Crh	A	T	3: 19,693,989 (GRCm38)	L163*	probably null	Het
Ctps	A	C	4: 120,552,878 (GRCm38)		probably null	Het
Cyb5d2	A	G	11: 72,795,575 (GRCm38)	V63A	probably damaging	Het
Cyp2d11	T	A	15: 82,391,071 (GRCm38)		probably null	Het
Dclk3	A	T	9: 111,467,788 (GRCm38)	E133D	probably damaging	Het
Dhrs9	A	G	2: 69,392,995 (GRCm38)	D29G	probably benign	Het
Disp2	G	A	2: 118,792,062 (GRCm38)	E1092K	probably benign	Het
Enpp3	A	G	10: 24,776,767 (GRCm38)	I764T	probably damaging	Het
Epm2aip1	C	A	9: 111,273,359 (GRCm38)	R467S	possibly damaging	Het
Fam20a	T	C	11: 109,677,885 (GRCm38)	I272V	probably benign	Het
Fgb	T	C	3: 83,043,373 (GRCm38)	Y358C	probably damaging	Het
Gm11596	A	T	11: 99,792,869 (GRCm38)	S142T	unknown	Het
Gm4858	G	T	3: 93,074,217 (GRCm38)	D181Y	probably damaging	Het
Golga4	A	G	9: 118,565,656 (GRCm38)	T9A	probably benign	Het
Hmcn2	C	T	2: 31,409,081 (GRCm38)	P2813L	probably damaging	Het
Ighv1-9	C	T	12: 114,583,820 (GRCm38)	G34R	probably damaging	Het
Klrk1	T	C	6: 129,617,503 (GRCm38)	Y42C	probably benign	Het
Lin9	T	A	1: 180,669,198 (GRCm38)	L351I	probably benign	Het
Mbtd1	T	C	11: 93,931,815 (GRCm38)	Y484H	probably benign	Het
Mki67	T	C	7: 135,707,904 (GRCm38)	R273G	possibly damaging	Het
Myh11	A	T	16: 14,239,527 (GRCm38)	L308*	probably null	Het
Nacc2	G	A	2: 26,090,138 (GRCm38)		probably null	Het
Nadsyn1	A	G	7: 143,806,969 (GRCm38)	L354P	probably damaging	Het
Ntrk3	T	A	7: 78,460,424 (GRCm38)	Q354L	probably benign	Het
Olfr1124	A	T	2: 87,435,146 (GRCm38)	I220L	probably damaging	Het
Olfr584	G	A	7: 103,086,457 (GRCm38)	G308E	probably benign	Het
Phactr3	T	C	2: 178,331,619 (GRCm38)	I470T	probably damaging	Het
Pkd1l3	C	T	8: 109,623,155 (GRCm38)	P211S	unknown	Het
Prickle2	T	C	6: 92,376,394 (GRCm38)	D753G	probably damaging	Het
Prr12	A	G	7: 45,049,894 (GRCm38)		probably benign	Het
Psd3	T	C	8: 67,713,825 (GRCm38)	E917G	probably damaging	Het
Rgsl1	T	A	1: 153,821,522 (GRCm38)	K551*	probably null	Het
Stag3	T	C	5: 138,304,478 (GRCm38)	L1033P	probably damaging	Het
Tcaf3	T	A	6: 42,593,684 (GRCm38)	Q378L	possibly damaging	Het
Tespa1	A	T	10: 130,362,035 (GRCm38)	K309*	probably null	Het
Trim69	A	G	2: 122,174,246 (GRCm38)	T275A	probably benign	Het
Txndc17	T	C	11: 72,207,711 (GRCm38)	Y30H	probably damaging	Het
Ugt2a2	A	T	5: 87,474,892 (GRCm38)	F72L	probably damaging	Het
Vmn2r59	A	T	7: 42,046,072 (GRCm38)	D305E	possibly damaging	Het
Vmn2r71	A	G	7: 85,624,389 (GRCm38)	I804V	probably benign	Het
Zfy2	T	C	Y: 2,107,159 (GRCm38)	K492E	possibly damaging	Het
Zkscan1	A	G	5: 138,100,920 (GRCm38)	H375R	probably damaging	Het

Other mutations in Kalrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Kalrn	APN	16	34,175,722 (GRCm38)	splice site	probably benign
IGL01364:Kalrn	APN	16	34,262,629 (GRCm38)	missense	probably damaging	1.00
IGL01510:Kalrn	APN	16	34,235,330 (GRCm38)	missense	possibly damaging	0.52
IGL01664:Kalrn	APN	16	34,294,161 (GRCm38)	missense	probably damaging	1.00
IGL01934:Kalrn	APN	16	34,198,512 (GRCm38)	splice site	probably null
IGL02059:Kalrn	APN	16	34,252,341 (GRCm38)	missense	possibly damaging	0.95
IGL02102:Kalrn	APN	16	34,220,222 (GRCm38)	missense	probably damaging	1.00
IGL02306:Kalrn	APN	16	34,310,527 (GRCm38)	missense	probably damaging	0.97
IGL02328:Kalrn	APN	16	34,332,224 (GRCm38)	missense	probably damaging	0.98
IGL02532:Kalrn	APN	16	34,360,846 (GRCm38)	missense	probably damaging	1.00
IGL02685:Kalrn	APN	16	34,513,959 (GRCm38)	nonsense	probably null
IGL02696:Kalrn	APN	16	34,220,114 (GRCm38)	missense	probably damaging	1.00
IGL02708:Kalrn	APN	16	34,392,050 (GRCm38)	missense	probably damaging	1.00
IGL02937:Kalrn	APN	16	34,220,130 (GRCm38)	nonsense	probably null
IGL03188:Kalrn	APN	16	34,314,192 (GRCm38)	missense	probably benign	0.01
IGL03289:Kalrn	APN	16	34,385,297 (GRCm38)	missense	possibly damaging	0.90
IGL03408:Kalrn	APN	16	34,314,176 (GRCm38)	missense	probably damaging	0.99
breeze	UTSW	16	34,013,675 (GRCm38)	missense
ethereal	UTSW	16	33,975,435 (GRCm38)	utr 3 prime	probably benign
Feather	UTSW	16	34,314,209 (GRCm38)	missense	probably damaging	0.99
Hidden	UTSW	16	34,027,976 (GRCm38)	missense	probably damaging	1.00
Soulful	UTSW	16	34,187,484 (GRCm38)	nonsense	probably null
G1Funyon:Kalrn	UTSW	16	34,357,100 (GRCm38)	missense	probably benign	0.05
PIT4498001:Kalrn	UTSW	16	34,031,582 (GRCm38)	missense	possibly damaging	0.81
R0019:Kalrn	UTSW	16	34,198,514 (GRCm38)	splice site	probably benign
R0043:Kalrn	UTSW	16	34,054,906 (GRCm38)	missense	probably damaging	1.00
R0052:Kalrn	UTSW	16	34,357,171 (GRCm38)	missense	probably damaging	1.00
R0066:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R0098:Kalrn	UTSW	16	33,975,619 (GRCm38)	missense	possibly damaging	0.89
R0098:Kalrn	UTSW	16	33,975,619 (GRCm38)	missense	possibly damaging	0.89
R0111:Kalrn	UTSW	16	34,031,590 (GRCm38)	missense	probably damaging	1.00
R0113:Kalrn	UTSW	16	34,049,936 (GRCm38)	intron	probably benign
R0183:Kalrn	UTSW	16	34,171,379 (GRCm38)	splice site	probably null
R0422:Kalrn	UTSW	16	34,314,273 (GRCm38)	missense	probably damaging	0.99
R0498:Kalrn	UTSW	16	34,054,891 (GRCm38)	missense	possibly damaging	0.61
R0614:Kalrn	UTSW	16	33,993,670 (GRCm38)	splice site	probably benign
R0656:Kalrn	UTSW	16	34,032,467 (GRCm38)	missense	probably damaging	1.00
R0671:Kalrn	UTSW	16	34,116,408 (GRCm38)	missense	probably benign	0.04
R0707:Kalrn	UTSW	16	34,010,581 (GRCm38)	missense	possibly damaging	0.88
R0709:Kalrn	UTSW	16	34,035,554 (GRCm38)	missense	probably damaging	1.00
R0834:Kalrn	UTSW	16	34,049,919 (GRCm38)	missense	possibly damaging	0.94
R0976:Kalrn	UTSW	16	34,385,390 (GRCm38)	missense	probably damaging	1.00
R1297:Kalrn	UTSW	16	34,016,498 (GRCm38)	missense	probably damaging	0.99
R1355:Kalrn	UTSW	16	33,975,584 (GRCm38)	missense	possibly damaging	0.74
R1370:Kalrn	UTSW	16	33,975,584 (GRCm38)	missense	possibly damaging	0.74
R1389:Kalrn	UTSW	16	33,988,803 (GRCm38)	missense	probably benign	0.01
R1398:Kalrn	UTSW	16	34,212,820 (GRCm38)	missense	probably damaging	1.00
R1427:Kalrn	UTSW	16	33,975,754 (GRCm38)	missense	probably damaging	1.00
R1458:Kalrn	UTSW	16	34,174,487 (GRCm38)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,187,471 (GRCm38)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,187,471 (GRCm38)	missense	probably damaging	1.00
R1557:Kalrn	UTSW	16	34,314,278 (GRCm38)	missense	possibly damaging	0.92
R1559:Kalrn	UTSW	16	34,010,548 (GRCm38)	missense	possibly damaging	0.92
R1654:Kalrn	UTSW	16	33,975,738 (GRCm38)	missense	probably damaging	1.00
R1703:Kalrn	UTSW	16	34,205,326 (GRCm38)	missense	probably damaging	1.00
R1759:Kalrn	UTSW	16	34,360,950 (GRCm38)	missense	probably damaging	0.97
R1764:Kalrn	UTSW	16	34,212,873 (GRCm38)	missense	probably damaging	1.00
R1824:Kalrn	UTSW	16	34,294,215 (GRCm38)	missense	probably damaging	1.00
R1845:Kalrn	UTSW	16	34,356,961 (GRCm38)	missense	probably damaging	0.99
R1850:Kalrn	UTSW	16	33,975,923 (GRCm38)	missense	probably damaging	0.98
R1921:Kalrn	UTSW	16	34,392,093 (GRCm38)	missense	probably benign	0.02
R1922:Kalrn	UTSW	16	34,392,093 (GRCm38)	missense	probably benign	0.02
R1970:Kalrn	UTSW	16	33,977,524 (GRCm38)	critical splice donor site	probably null
R1991:Kalrn	UTSW	16	33,975,738 (GRCm38)	missense	probably damaging	1.00
R1992:Kalrn	UTSW	16	33,975,738 (GRCm38)	missense	probably damaging	1.00
R2001:Kalrn	UTSW	16	34,028,045 (GRCm38)	missense	probably damaging	1.00
R2025:Kalrn	UTSW	16	34,189,736 (GRCm38)	missense	probably damaging	0.96
R2048:Kalrn	UTSW	16	34,252,310 (GRCm38)	missense	probably benign	0.18
R2076:Kalrn	UTSW	16	34,332,143 (GRCm38)	missense	probably benign	0.15
R2118:Kalrn	UTSW	16	34,332,230 (GRCm38)	missense	possibly damaging	0.84
R2136:Kalrn	UTSW	16	34,307,724 (GRCm38)	missense	possibly damaging	0.82
R2145:Kalrn	UTSW	16	34,009,262 (GRCm38)	unclassified	probably benign
R2193:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2195:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2234:Kalrn	UTSW	16	34,176,262 (GRCm38)	splice site	probably null
R2404:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2405:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2408:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2411:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2570:Kalrn	UTSW	16	34,310,495 (GRCm38)	missense	probably damaging	1.00
R2903:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2904:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2924:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R3411:Kalrn	UTSW	16	34,212,272 (GRCm38)	missense	probably benign	0.07
R3693:Kalrn	UTSW	16	34,357,315 (GRCm38)	missense	probably damaging	1.00
R3709:Kalrn	UTSW	16	34,392,030 (GRCm38)	splice site	probably null
R3788:Kalrn	UTSW	16	34,220,240 (GRCm38)	missense	probably damaging	1.00
R3833:Kalrn	UTSW	16	34,039,889 (GRCm38)	nonsense	probably null
R3871:Kalrn	UTSW	16	34,203,856 (GRCm38)	splice site	probably null
R3934:Kalrn	UTSW	16	34,310,531 (GRCm38)	missense	probably benign	0.34
R4033:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4056:Kalrn	UTSW	16	34,314,209 (GRCm38)	missense	probably damaging	0.99
R4057:Kalrn	UTSW	16	34,314,209 (GRCm38)	missense	probably damaging	0.99
R4303:Kalrn	UTSW	16	34,235,391 (GRCm38)	missense	probably damaging	1.00
R4402:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4444:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4482:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4487:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4558:Kalrn	UTSW	16	33,987,208 (GRCm38)	missense	possibly damaging	0.46
R4572:Kalrn	UTSW	16	34,392,042 (GRCm38)	missense	probably damaging	0.98
R4583:Kalrn	UTSW	16	34,235,267 (GRCm38)	missense	probably damaging	1.00
R4604:Kalrn	UTSW	16	34,513,926 (GRCm38)	missense	possibly damaging	0.46
R4620:Kalrn	UTSW	16	34,028,705 (GRCm38)	missense	probably damaging	0.99
R4651:Kalrn	UTSW	16	34,176,391 (GRCm38)	missense	probably damaging	1.00
R4703:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R4704:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R4705:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R4760:Kalrn	UTSW	16	34,198,487 (GRCm38)	missense	probably damaging	1.00
R4793:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4794:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4811:Kalrn	UTSW	16	34,356,969 (GRCm38)	missense	probably damaging	1.00
R4816:Kalrn	UTSW	16	34,514,019 (GRCm38)	unclassified	probably benign
R4888:Kalrn	UTSW	16	34,171,330 (GRCm38)	missense	probably damaging	1.00
R4952:Kalrn	UTSW	16	34,357,415 (GRCm38)	splice site	probably null
R5030:Kalrn	UTSW	16	33,975,742 (GRCm38)	missense	probably benign	0.00
R5117:Kalrn	UTSW	16	34,033,601 (GRCm38)	critical splice acceptor site	probably null
R5289:Kalrn	UTSW	16	34,252,341 (GRCm38)	missense	possibly damaging	0.95
R5426:Kalrn	UTSW	16	34,262,653 (GRCm38)	missense	probably damaging	1.00
R5432:Kalrn	UTSW	16	34,053,622 (GRCm38)	missense	probably damaging	1.00
R5611:Kalrn	UTSW	16	34,175,780 (GRCm38)	missense	probably damaging	1.00
R5629:Kalrn	UTSW	16	34,039,934 (GRCm38)	missense	possibly damaging	0.77
R5635:Kalrn	UTSW	16	34,014,084 (GRCm38)	missense	probably damaging	1.00
R5713:Kalrn	UTSW	16	34,016,579 (GRCm38)	missense	probably benign
R5716:Kalrn	UTSW	16	33,987,176 (GRCm38)	missense	probably benign	0.01
R5772:Kalrn	UTSW	16	33,975,820 (GRCm38)	missense	probably damaging	1.00
R5797:Kalrn	UTSW	16	34,212,249 (GRCm38)	missense	probably damaging	0.98
R5835:Kalrn	UTSW	16	33,987,091 (GRCm38)	missense	probably benign	0.28
R5895:Kalrn	UTSW	16	33,975,435 (GRCm38)	utr 3 prime	probably benign
R5924:Kalrn	UTSW	16	34,243,833 (GRCm38)	missense	probably damaging	1.00
R5999:Kalrn	UTSW	16	34,357,343 (GRCm38)	missense	probably damaging	1.00
R6010:Kalrn	UTSW	16	34,010,580 (GRCm38)	missense	probably benign	0.06
R6052:Kalrn	UTSW	16	34,360,885 (GRCm38)	missense	probably damaging	1.00
R6122:Kalrn	UTSW	16	33,985,191 (GRCm38)	missense	possibly damaging	0.82
R6128:Kalrn	UTSW	16	34,212,885 (GRCm38)	missense	probably damaging	0.99
R6136:Kalrn	UTSW	16	34,357,111 (GRCm38)	missense	probably damaging	1.00
R6178:Kalrn	UTSW	16	34,053,639 (GRCm38)	missense	possibly damaging	0.88
R6229:Kalrn	UTSW	16	34,055,071 (GRCm38)	missense	probably damaging	1.00
R6376:Kalrn	UTSW	16	33,975,991 (GRCm38)	missense	probably benign
R6397:Kalrn	UTSW	16	33,992,985 (GRCm38)	missense	probably damaging	1.00
R6429:Kalrn	UTSW	16	34,332,164 (GRCm38)	missense	possibly damaging	0.85
R6473:Kalrn	UTSW	16	34,205,302 (GRCm38)	missense	probably damaging	1.00
R6481:Kalrn	UTSW	16	34,360,984 (GRCm38)	missense	probably damaging	1.00
R6597:Kalrn	UTSW	16	34,182,747 (GRCm38)	missense	probably damaging	1.00
R6736:Kalrn	UTSW	16	34,217,923 (GRCm38)	missense	probably damaging	1.00
R6808:Kalrn	UTSW	16	34,027,976 (GRCm38)	missense	probably damaging	1.00
R6897:Kalrn	UTSW	16	33,975,703 (GRCm38)	missense	probably damaging	0.99
R6955:Kalrn	UTSW	16	34,220,136 (GRCm38)	missense	probably damaging	1.00
R7060:Kalrn	UTSW	16	34,357,048 (GRCm38)	missense	probably damaging	0.99
R7064:Kalrn	UTSW	16	34,217,891 (GRCm38)	missense	probably damaging	1.00
R7132:Kalrn	UTSW	16	34,256,227 (GRCm38)	missense	unknown
R7154:Kalrn	UTSW	16	34,212,157 (GRCm38)	critical splice donor site	probably null
R7181:Kalrn	UTSW	16	34,163,077 (GRCm38)	missense	probably benign	0.00
R7234:Kalrn	UTSW	16	34,176,422 (GRCm38)	missense	possibly damaging	0.63
R7235:Kalrn	UTSW	16	34,175,761 (GRCm38)	missense	probably benign	0.18
R7504:Kalrn	UTSW	16	34,256,233 (GRCm38)	missense	unknown
R7563:Kalrn	UTSW	16	34,392,094 (GRCm38)	missense	probably damaging	0.97
R7612:Kalrn	UTSW	16	34,314,212 (GRCm38)	missense	possibly damaging	0.68
R7772:Kalrn	UTSW	16	34,031,582 (GRCm38)	missense	probably benign	0.04
R7796:Kalrn	UTSW	16	34,187,484 (GRCm38)	nonsense	probably null
R7867:Kalrn	UTSW	16	33,989,791 (GRCm38)	missense	possibly damaging	0.94
R7869:Kalrn	UTSW	16	33,988,847 (GRCm38)	missense	probably damaging	0.98
R7914:Kalrn	UTSW	16	34,028,752 (GRCm38)	missense	probably benign
R8080:Kalrn	UTSW	16	33,975,668 (GRCm38)	missense	possibly damaging	0.83
R8147:Kalrn	UTSW	16	34,055,044 (GRCm38)	missense	probably benign
R8239:Kalrn	UTSW	16	34,049,783 (GRCm38)	missense	noncoding transcript
R8281:Kalrn	UTSW	16	34,035,061 (GRCm38)	nonsense	probably null
R8294:Kalrn	UTSW	16	34,033,584 (GRCm38)	missense	probably benign	0.12
R8301:Kalrn	UTSW	16	34,357,100 (GRCm38)	missense	probably benign	0.05
R8686:Kalrn	UTSW	16	34,360,935 (GRCm38)	missense	probably damaging	1.00
R8693:Kalrn	UTSW	16	34,034,514 (GRCm38)	missense	probably damaging	1.00
R8798:Kalrn	UTSW	16	33,982,855 (GRCm38)	missense	possibly damaging	0.65
R8878:Kalrn	UTSW	16	34,205,326 (GRCm38)	missense	probably damaging	1.00
R8878:Kalrn	UTSW	16	34,198,460 (GRCm38)	missense	probably benign	0.05
R8880:Kalrn	UTSW	16	34,217,935 (GRCm38)	missense	probably damaging	1.00
R8883:Kalrn	UTSW	16	33,993,655 (GRCm38)	missense	probably damaging	1.00
R8887:Kalrn	UTSW	16	34,227,126 (GRCm38)	missense	probably benign	0.22
R9048:Kalrn	UTSW	16	34,034,484 (GRCm38)	missense	possibly damaging	0.84
R9111:Kalrn	UTSW	16	34,361,001 (GRCm38)	missense	probably damaging	0.96
R9317:Kalrn	UTSW	16	34,013,675 (GRCm38)	missense
R9424:Kalrn	UTSW	16	33,988,818 (GRCm38)	missense	probably benign	0.06
R9442:Kalrn	UTSW	16	34,095,879 (GRCm38)	start codon destroyed	probably null	0.56
R9445:Kalrn	UTSW	16	33,985,230 (GRCm38)	missense	probably benign	0.13
R9515:Kalrn	UTSW	16	34,034,494 (GRCm38)	missense	probably damaging	1.00
R9516:Kalrn	UTSW	16	34,034,494 (GRCm38)	missense	probably damaging	1.00
R9625:Kalrn	UTSW	16	34,028,827 (GRCm38)	critical splice acceptor site	probably null
R9645:Kalrn	UTSW	16	34,212,213 (GRCm38)	missense	probably benign	0.01
RF014:Kalrn	UTSW	16	34,039,933 (GRCm38)	missense	probably benign	0.01
Z1177:Kalrn	UTSW	16	34,035,506 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGAACACAGCAGACATGGC -3'
(R):5'- TTGGCATGCATACAGTCTGTG -3'

Sequencing Primer
(F):5'- ACATGGCCAGGATTGTACTGC -3'
(R):5'- AACTGTTTCAGCTCTGGAAGGAC -3'

Posted On

2016-06-15