Incidental Mutation 'R5045:Cd2ap'
ID394353
Institutional Source Beutler Lab
Gene Symbol Cd2ap
Ensembl Gene ENSMUSG00000061665
Gene NameCD2-associated protein
SynonymsMets1, METS-1
MMRRC Submission 042635-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5045 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location42792951-42876424 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42807960 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 529 (N529S)
Ref Sequence ENSEMBL: ENSMUSP00000024709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024709]
PDB Structure
Third SH3 domain of CD2AP [SOLUTION NMR]
RDC refined solution structure of the first SH3 domain of CD2AP [SOLUTION NMR]
High resolution structure of the second SH3 domain of CD2AP [SOLUTION NMR]
RDC refined high resolution structure of the third SH3 domain of CD2AP [SOLUTION NMR]
Distinct ubiquitin binding modes exhibited by sh3 domains: molecular determinants and functional implications [SOLUTION NMR]
Distinct ubiquitin binding modes exhibited by SH3 domains: molecular determinants and functional implications [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000024709
AA Change: N529S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000024709
Gene: ENSMUSG00000061665
AA Change: N529S

DomainStartEndE-ValueType
SH3 2 58 4.48e-19 SMART
SH3 111 166 6.63e-22 SMART
low complexity region 183 195 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SH3 272 329 4.62e-21 SMART
low complexity region 336 352 N/A INTRINSIC
low complexity region 377 399 N/A INTRINSIC
low complexity region 410 422 N/A INTRINSIC
PDB:3LK4|9 475 503 2e-12 PDB
low complexity region 536 555 N/A INTRINSIC
coiled coil region 595 635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a scaffolding molecule that regulates the actin cytoskeleton. The protein directly interacts with filamentous actin and a variety of cell membrane proteins through multiple actin binding sites, SH3 domains, and a proline-rich region containing binding sites for SH3 domains. The cytoplasmic protein localizes to membrane ruffles, lipid rafts, and the leading edges of cells. It is implicated in dynamic actin remodeling and membrane trafficking that occurs during receptor endocytosis and cytokinesis. The mouse genome contains at least two pseudogenes located on chromosomes 9 and 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired immune function and die at 6 to 7 weeks of age from kidney failure associated with podocyte defects and mesangial cell hyperplasia. Heterozygotes develop glomerular changes around 9 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,476,178 probably benign Het
2210408I21Rik A G 13: 77,267,808 probably null Het
4930430A15Rik T A 2: 111,193,459 Q110L unknown Het
4930519P11Rik A T 2: 154,613,030 C136* probably null Het
4930519P11Rik G T 2: 154,613,062 probably benign Het
Adgrb3 T A 1: 25,074,779 H1189L probably damaging Het
Arhgap24 A G 5: 102,891,877 I227V possibly damaging Het
Arhgap29 C A 3: 122,002,595 N445K probably benign Het
Atp13a3 T C 16: 30,339,876 H811R probably benign Het
Cdh7 T A 1: 110,098,350 S439T probably benign Het
Ces3a G T 8: 105,050,616 probably null Het
Cftr T A 6: 18,230,081 N408K probably benign Het
Chil5 T C 3: 106,024,140 N136S possibly damaging Het
Col20a1 A G 2: 181,006,845 D933G probably damaging Het
Crh A T 3: 19,693,989 L163* probably null Het
Ctps A C 4: 120,552,878 probably null Het
Cyb5d2 A G 11: 72,795,575 V63A probably damaging Het
Cyp2d11 T A 15: 82,391,071 probably null Het
Dclk3 A T 9: 111,467,788 E133D probably damaging Het
Dhrs9 A G 2: 69,392,995 D29G probably benign Het
Disp2 G A 2: 118,792,062 E1092K probably benign Het
Enpp3 A G 10: 24,776,767 I764T probably damaging Het
Epm2aip1 C A 9: 111,273,359 R467S possibly damaging Het
Fam20a T C 11: 109,677,885 I272V probably benign Het
Fgb T C 3: 83,043,373 Y358C probably damaging Het
Gm11596 A T 11: 99,792,869 S142T unknown Het
Gm4858 G T 3: 93,074,217 D181Y probably damaging Het
Golga4 A G 9: 118,565,656 T9A probably benign Het
Hmcn2 C T 2: 31,409,081 P2813L probably damaging Het
Ighv1-9 C T 12: 114,583,820 G34R probably damaging Het
Kalrn A C 16: 34,314,352 Y353* probably null Het
Klrk1 T C 6: 129,617,503 Y42C probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mbtd1 T C 11: 93,931,815 Y484H probably benign Het
Mki67 T C 7: 135,707,904 R273G possibly damaging Het
Myh11 A T 16: 14,239,527 L308* probably null Het
Nacc2 G A 2: 26,090,138 probably null Het
Nadsyn1 A G 7: 143,806,969 L354P probably damaging Het
Ntrk3 T A 7: 78,460,424 Q354L probably benign Het
Olfr1124 A T 2: 87,435,146 I220L probably damaging Het
Olfr584 G A 7: 103,086,457 G308E probably benign Het
Phactr3 T C 2: 178,331,619 I470T probably damaging Het
Pkd1l3 C T 8: 109,623,155 P211S unknown Het
Prickle2 T C 6: 92,376,394 D753G probably damaging Het
Prr12 A G 7: 45,049,894 probably benign Het
Psd3 T C 8: 67,713,825 E917G probably damaging Het
Rgsl1 T A 1: 153,821,522 K551* probably null Het
Stag3 T C 5: 138,304,478 L1033P probably damaging Het
Tcaf3 T A 6: 42,593,684 Q378L possibly damaging Het
Tespa1 A T 10: 130,362,035 K309* probably null Het
Trim69 A G 2: 122,174,246 T275A probably benign Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Ugt2a2 A T 5: 87,474,892 F72L probably damaging Het
Vmn2r59 A T 7: 42,046,072 D305E possibly damaging Het
Vmn2r71 A G 7: 85,624,389 I804V probably benign Het
Zfy2 T C Y: 2,107,159 K492E possibly damaging Het
Zkscan1 A G 5: 138,100,920 H375R probably damaging Het
Other mutations in Cd2ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Cd2ap APN 17 42808785 missense probably benign 0.16
IGL00909:Cd2ap APN 17 42830114 splice site probably benign
IGL01321:Cd2ap APN 17 42845389 missense possibly damaging 0.71
IGL01350:Cd2ap APN 17 42825921 nonsense probably null
IGL01485:Cd2ap APN 17 42852474 missense probably damaging 1.00
IGL01834:Cd2ap APN 17 42826360 critical splice acceptor site probably null
IGL01834:Cd2ap APN 17 42826361 critical splice acceptor site probably null
PIT4494001:Cd2ap UTSW 17 42852367 critical splice donor site probably null
R0014:Cd2ap UTSW 17 42807928 missense probably benign
R0331:Cd2ap UTSW 17 42805301 missense probably benign 0.06
R0674:Cd2ap UTSW 17 42845392 missense possibly damaging 0.89
R1471:Cd2ap UTSW 17 42820597 missense probably benign 0.00
R1806:Cd2ap UTSW 17 42838758 nonsense probably null
R3858:Cd2ap UTSW 17 42816572 nonsense probably null
R3911:Cd2ap UTSW 17 42816089 critical splice acceptor site probably null
R3941:Cd2ap UTSW 17 42808799 missense probably damaging 0.99
R4766:Cd2ap UTSW 17 42852459 missense probably damaging 0.99
R5024:Cd2ap UTSW 17 42805345 splice site probably null
R6051:Cd2ap UTSW 17 42796328 makesense probably null
R6063:Cd2ap UTSW 17 42825911 missense probably benign 0.00
R7034:Cd2ap UTSW 17 42798599 missense probably damaging 1.00
R7036:Cd2ap UTSW 17 42798599 missense probably damaging 1.00
R7214:Cd2ap UTSW 17 42845394 missense possibly damaging 0.61
R7299:Cd2ap UTSW 17 42830013 nonsense probably null
R7301:Cd2ap UTSW 17 42830013 nonsense probably null
R7402:Cd2ap UTSW 17 42805163 missense possibly damaging 0.88
Z1088:Cd2ap UTSW 17 42807993 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTAAGAGCTACAGAAGACAGTGTG -3'
(R):5'- TTGTCCACAGCAGTAAACAGCAG -3'

Sequencing Primer
(F):5'- ACAGTGTGTCTTAAGCTTAATAATGC -3'
(R):5'- GTTTAACATTTAGCCAACCCAA -3'
Posted On2016-06-15