Mutagenetix > Incidental Mutations

Incidental Mutation 'R5046:Pign'

394356

Institutional Source

Beutler Lab

Gene Symbol

Pign

Ensembl Gene

ENSMUSG00000056536

Gene Name

phosphatidylinositol glycan anchor biosynthesis, class N

Synonyms

MMRRC Submission

042636-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.823) question?

Stock #

R5046 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105518422-105663677 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 105522073 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 909 (N909K)

Ref Sequence

ENSEMBL: ENSMUSP00000139638 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070699] [ENSMUST00000186485]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070699
AA Change: N909K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000069969
Gene: ENSMUSG00000056536
AA Change: N909K

Domain	Start	End	E-Value	Type
transmembrane domain	2	24	N/A	INTRINSIC
Pfam:Phosphodiest	116	303	1.2e-10	PFAM
Pfam:Sulfatase	148	334	2.1e-8	PFAM
low complexity region	382	393	N/A	INTRINSIC
Pfam:PigN	430	884	2.3e-138	PFAM
transmembrane domain	893	915	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000186485
AA Change: N909K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000139638
Gene: ENSMUSG00000056536
AA Change: N909K

Domain	Start	End	E-Value	Type
transmembrane domain	2	24	N/A	INTRINSIC
Pfam:Phosphodiest	109	330	3.7e-11	PFAM
Pfam:Sulfatase	148	334	2.1e-8	PFAM
low complexity region	382	393	N/A	INTRINSIC
Pfam:PigN	430	884	1.5e-141	PFAM
transmembrane domain	893	915	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188743

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190139

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190945

Meta Mutation Damage Score

0.0935

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is expressed in the endoplasmic reticulum and transfers phosphoethanolamine (EtNP) to the first mannose of the GPI anchor. Two alternatively spliced variants, which encode an identical isoform, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal gastrulation, forebrain hypoplasia, coloboma, and microphthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,620,354	M182R	probably benign	Het
Acsm4	C	A	7: 119,703,374	H241N	probably damaging	Het
Arhgap32	G	A	9: 32,256,799	A693T	probably damaging	Het
B4galnt3	G	T	6: 120,214,798	A658D	probably damaging	Het
Car12	G	A	9: 66,746,613	E84K	probably benign	Het
Crocc2	T	A	1: 93,205,902	S969T	probably damaging	Het
Crym	A	G	7: 120,195,444	V184A	possibly damaging	Het
Cryzl2	T	C	1: 157,465,013	C122R	probably damaging	Het
Defb30	T	C	14: 63,036,014	E49G	probably benign	Het
Dnah3	A	G	7: 119,951,580	L3161P	probably damaging	Het
Dnajc5g	A	G	5: 31,109,692	N104S	probably benign	Het
Fcgr1	T	G	3: 96,286,986	K195T	probably damaging	Het
Gal	C	T	19: 3,411,167	R89H	probably damaging	Het
Gcfc2	C	T	6: 81,948,335	A577V	probably benign	Het
Gm5116	A	C	7: 32,495,954		noncoding transcript	Het
Golga3	A	T	5: 110,192,940	Q540L	probably damaging	Het
Hectd1	T	C	12: 51,750,388	E2184G	probably damaging	Het
Hspa12a	T	C	19: 58,799,545	D615G	probably damaging	Het
Igkv14-130	A	T	6: 67,791,481	Y107F	probably damaging	Het
Ldlr	T	A	9: 21,745,907		probably null	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Lrrc37a	A	T	11: 103,498,240	S2120T	unknown	Het
Mtfmt	G	T	9: 65,439,615	V164F	probably damaging	Het
Nampt	T	C	12: 32,833,038	V74A	probably damaging	Het
Ndufc2	G	T	7: 97,407,664	R120L	probably damaging	Het
Neo1	A	T	9: 58,893,911	V1156D	possibly damaging	Het
Nlrp1b	G	A	11: 71,160,072	P1065S	possibly damaging	Het
Nop9	A	G	14: 55,745,940	H56R	possibly damaging	Het
Olfr1287	A	T	2: 111,449,589	T150S	probably benign	Het
Olfr790	A	T	10: 129,501,309	M142L	possibly damaging	Het
Prex1	A	G	2: 166,572,963	V304A	probably benign	Het
Racgap1	G	A	15: 99,628,762	R307W	probably damaging	Het
Rap1gds1	C	A	3: 138,955,420	E399*	probably null	Het
Rwdd4a	G	A	8: 47,542,802		probably null	Het
Scp2	T	C	4: 108,071,291	T401A	probably benign	Het
Sdha	A	G	13: 74,327,333	F526S	probably damaging	Het
Shroom1	T	A	11: 53,464,045	L264Q	probably benign	Het
Sorl1	T	C	9: 41,996,294	T1466A	probably benign	Het
Trpm2	C	T	10: 77,966,018	C71Y	probably damaging	Het
Ugt2b34	G	A	5: 86,904,387	S250L	probably benign	Het
Vmn2r88	A	G	14: 51,413,181	D117G	probably benign	Het
Wdr73	A	T	7: 80,892,425		probably benign	Het

Other mutations in Pign

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Pign	APN	1	105597723	nonsense	probably null
IGL00770:Pign	APN	1	105597756	missense	probably benign	0.00
IGL00774:Pign	APN	1	105597756	missense	probably benign	0.00
IGL00828:Pign	APN	1	105554120	missense	probably damaging	0.97
IGL01407:Pign	APN	1	105589302	missense	probably benign	0.06
IGL01523:Pign	APN	1	105653178	missense	probably damaging	0.98
IGL01953:Pign	APN	1	105589039	splice site	probably benign
IGL02389:Pign	APN	1	105646781	nonsense	probably null
PIT4810001:Pign	UTSW	1	105597762	missense	possibly damaging	0.83
R0080:Pign	UTSW	1	105552405	missense	probably damaging	1.00
R0097:Pign	UTSW	1	105587976	splice site	probably benign
R0302:Pign	UTSW	1	105589093	missense	possibly damaging	0.83
R0573:Pign	UTSW	1	105653177	missense	probably damaging	1.00
R0580:Pign	UTSW	1	105591694	missense	probably benign	0.03
R0946:Pign	UTSW	1	105591697	missense	probably benign	0.00
R1397:Pign	UTSW	1	105657771	missense	probably damaging	1.00
R1462:Pign	UTSW	1	105585002	missense	possibly damaging	0.95
R1462:Pign	UTSW	1	105585002	missense	possibly damaging	0.95
R1751:Pign	UTSW	1	105653192	missense	probably benign	0.19
R1753:Pign	UTSW	1	105589317	missense	possibly damaging	0.65
R1767:Pign	UTSW	1	105653192	missense	probably benign	0.19
R1854:Pign	UTSW	1	105554498	missense	probably damaging	0.99
R1907:Pign	UTSW	1	105638215	missense	possibly damaging	0.50
R2845:Pign	UTSW	1	105657796	missense	possibly damaging	0.80
R2846:Pign	UTSW	1	105657796	missense	possibly damaging	0.80
R3718:Pign	UTSW	1	105649281	critical splice donor site	probably null
R3970:Pign	UTSW	1	105656003	missense	probably damaging	1.00
R4067:Pign	UTSW	1	105587978	critical splice donor site	probably null
R4110:Pign	UTSW	1	105553815	unclassified	probably benign
R4387:Pign	UTSW	1	105522060	missense	possibly damaging	0.48
R4393:Pign	UTSW	1	105522026	missense	probably benign	0.00
R4472:Pign	UTSW	1	105648220	missense	probably benign	0.29
R4519:Pign	UTSW	1	105597666	critical splice donor site	probably null
R4619:Pign	UTSW	1	105521990	utr 3 prime	probably benign
R4746:Pign	UTSW	1	105585024	missense	probably benign	0.33
R4859:Pign	UTSW	1	105648167	nonsense	probably null
R4893:Pign	UTSW	1	105646711	missense	probably damaging	1.00
R4953:Pign	UTSW	1	105644502	missense	probably benign	0.32
R5377:Pign	UTSW	1	105657812	missense	probably benign	0.12
R5388:Pign	UTSW	1	105655970	missense	probably damaging	1.00
R5482:Pign	UTSW	1	105546710	missense	probably benign	0.44
R5594:Pign	UTSW	1	105646869	intron	probably benign
R5639:Pign	UTSW	1	105589315	missense	probably benign	0.09
R5778:Pign	UTSW	1	105591722	missense	probably damaging	1.00
R5821:Pign	UTSW	1	105589063	missense	possibly damaging	0.95
R5928:Pign	UTSW	1	105558067	missense	possibly damaging	0.55
R5979:Pign	UTSW	1	105589274	missense	probably benign	0.01
R6213:Pign	UTSW	1	105589266	missense	possibly damaging	0.50
R6292:Pign	UTSW	1	105585077	missense	possibly damaging	0.69
R6343:Pign	UTSW	1	105585095	missense	probably benign	0.33
R6566:Pign	UTSW	1	105638181	critical splice donor site	probably null
R6856:Pign	UTSW	1	105553895	nonsense	probably null
R6954:Pign	UTSW	1	105553897	missense	probably benign	0.39
R7361:Pign	UTSW	1	105585053	missense	probably benign	0.01
R7582:Pign	UTSW	1	105649367	missense	probably benign	0.00
R7622:Pign	UTSW	1	105648117	missense	possibly damaging	0.65
R7742:Pign	UTSW	1	105552397	missense	probably benign
R7892:Pign	UTSW	1	105657676	missense	probably benign	0.01
R7975:Pign	UTSW	1	105657676	missense	probably benign	0.01
R8273:Pign	UTSW	1	105589078	missense	probably benign	0.00
X0025:Pign	UTSW	1	105657634	missense	probably benign	0.03
Z1177:Pign	UTSW	1	105657820	start codon destroyed	probably null	0.98

Predicted Primers

PCR Primer
(F):5'- TGCATGACATATGTGCAAGTG -3'
(R):5'- CATTGGTACCTTTTCTAATTCTATGCA -3'

Sequencing Primer
(F):5'- TCCAGGGATCAAACTCAGGTTGTC -3'
(R):5'- TTAATTGGAGGCATCTTGG -3'

Posted On

2016-06-15