Incidental Mutation 'R5046:Igkv14-130'
ID394366
Institutional Source Beutler Lab
Gene Symbol Igkv14-130
Ensembl Gene ENSMUSG00000096461
Gene Nameimmunoglobulin kappa variable 14-130
Synonyms
MMRRC Submission 042636-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R5046 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location67791046-67791511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67791481 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 107 (Y107F)
Ref Sequence ENSEMBL: ENSMUSP00000100108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103307] [ENSMUST00000196006]
Predicted Effect probably damaging
Transcript: ENSMUST00000103307
AA Change: Y107F

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100108
Gene: ENSMUSG00000096461
AA Change: Y107F

DomainStartEndE-ValueType
IGv 39 111 6.38e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158532
Predicted Effect probably damaging
Transcript: ENSMUST00000196006
AA Change: Y108F

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143018
Gene: ENSMUSG00000096461
AA Change: Y108F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGv 40 112 2.6e-22 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,620,354 M182R probably benign Het
Acsm4 C A 7: 119,703,374 H241N probably damaging Het
Arhgap32 G A 9: 32,256,799 A693T probably damaging Het
B4galnt3 G T 6: 120,214,798 A658D probably damaging Het
Car12 G A 9: 66,746,613 E84K probably benign Het
Crocc2 T A 1: 93,205,902 S969T probably damaging Het
Crym A G 7: 120,195,444 V184A possibly damaging Het
Cryzl2 T C 1: 157,465,013 C122R probably damaging Het
Defb30 T C 14: 63,036,014 E49G probably benign Het
Dnah3 A G 7: 119,951,580 L3161P probably damaging Het
Dnajc5g A G 5: 31,109,692 N104S probably benign Het
Fcgr1 T G 3: 96,286,986 K195T probably damaging Het
Gal C T 19: 3,411,167 R89H probably damaging Het
Gcfc2 C T 6: 81,948,335 A577V probably benign Het
Gm5116 A C 7: 32,495,954 noncoding transcript Het
Golga3 A T 5: 110,192,940 Q540L probably damaging Het
Hectd1 T C 12: 51,750,388 E2184G probably damaging Het
Hspa12a T C 19: 58,799,545 D615G probably damaging Het
Ldlr T A 9: 21,745,907 probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrrc37a A T 11: 103,498,240 S2120T unknown Het
Mtfmt G T 9: 65,439,615 V164F probably damaging Het
Nampt T C 12: 32,833,038 V74A probably damaging Het
Ndufc2 G T 7: 97,407,664 R120L probably damaging Het
Neo1 A T 9: 58,893,911 V1156D possibly damaging Het
Nlrp1b G A 11: 71,160,072 P1065S possibly damaging Het
Nop9 A G 14: 55,745,940 H56R possibly damaging Het
Olfr1287 A T 2: 111,449,589 T150S probably benign Het
Olfr790 A T 10: 129,501,309 M142L possibly damaging Het
Pign A T 1: 105,522,073 N909K possibly damaging Het
Prex1 A G 2: 166,572,963 V304A probably benign Het
Racgap1 G A 15: 99,628,762 R307W probably damaging Het
Rap1gds1 C A 3: 138,955,420 E399* probably null Het
Rwdd4a G A 8: 47,542,802 probably null Het
Scp2 T C 4: 108,071,291 T401A probably benign Het
Sdha A G 13: 74,327,333 F526S probably damaging Het
Shroom1 T A 11: 53,464,045 L264Q probably benign Het
Sorl1 T C 9: 41,996,294 T1466A probably benign Het
Trpm2 C T 10: 77,966,018 C71Y probably damaging Het
Ugt2b34 G A 5: 86,904,387 S250L probably benign Het
Vmn2r88 A G 14: 51,413,181 D117G probably benign Het
Wdr73 A T 7: 80,892,425 probably benign Het
Other mutations in Igkv14-130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01909:Igkv14-130 APN 6 67791339 missense possibly damaging 0.88
PIT4362001:Igkv14-130 UTSW 6 67791408 missense probably damaging 1.00
R4760:Igkv14-130 UTSW 6 67791462 missense probably benign 0.00
R5922:Igkv14-130 UTSW 6 67791222 missense probably damaging 1.00
R6189:Igkv14-130 UTSW 6 67791448 missense probably damaging 1.00
R6579:Igkv14-130 UTSW 6 67791437 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATGTCTGCATCTCTGGGAGAC -3'
(R):5'- TGACATGACCCAGGACTCTC -3'

Sequencing Primer
(F):5'- TGGGAGACAGAATAACCATCACTTGC -3'
(R):5'- TCTCAGAGAGACATGTGACATCTG -3'
Posted On2016-06-15