Incidental Mutation 'R5046:Gcfc2'
ID394367
Institutional Source Beutler Lab
Gene Symbol Gcfc2
Ensembl Gene ENSMUSG00000035125
Gene NameGC-rich sequence DNA binding factor 2
SynonymsAW146020
MMRRC Submission 042636-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R5046 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location81923669-81959915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81948335 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 577 (A577V)
Ref Sequence ENSEMBL: ENSMUSP00000035644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043195] [ENSMUST00000152996]
Predicted Effect probably benign
Transcript: ENSMUST00000043195
AA Change: A577V

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000035644
Gene: ENSMUSG00000035125
AA Change: A577V

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
coiled coil region 255 308 N/A INTRINSIC
low complexity region 392 406 N/A INTRINSIC
Pfam:GCFC 456 672 3e-34 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132301
Predicted Effect probably benign
Transcript: ENSMUST00000152996
SMART Domains Protein: ENSMUSP00000138136
Gene: ENSMUSG00000035125

DomainStartEndE-ValueType
low complexity region 16 24 N/A INTRINSIC
low complexity region 43 66 N/A INTRINSIC
low complexity region 97 111 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203959
AA Change: A61V

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The first mRNA transcript isolated for this gene was part of an artificial chimera derived from two distinct gene transcripts and a primer used in the cloning process (see Genbank accession M29204). A positively charged amino terminus present only in the chimera was determined to bind GC-rich DNA, thus mistakenly thought to identify a transcription factor gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,620,354 M182R probably benign Het
Acsm4 C A 7: 119,703,374 H241N probably damaging Het
Arhgap32 G A 9: 32,256,799 A693T probably damaging Het
B4galnt3 G T 6: 120,214,798 A658D probably damaging Het
Car12 G A 9: 66,746,613 E84K probably benign Het
Crocc2 T A 1: 93,205,902 S969T probably damaging Het
Crym A G 7: 120,195,444 V184A possibly damaging Het
Cryzl2 T C 1: 157,465,013 C122R probably damaging Het
Defb30 T C 14: 63,036,014 E49G probably benign Het
Dnah3 A G 7: 119,951,580 L3161P probably damaging Het
Dnajc5g A G 5: 31,109,692 N104S probably benign Het
Fcgr1 T G 3: 96,286,986 K195T probably damaging Het
Gal C T 19: 3,411,167 R89H probably damaging Het
Gm5116 A C 7: 32,495,954 noncoding transcript Het
Golga3 A T 5: 110,192,940 Q540L probably damaging Het
Hectd1 T C 12: 51,750,388 E2184G probably damaging Het
Hspa12a T C 19: 58,799,545 D615G probably damaging Het
Igkv14-130 A T 6: 67,791,481 Y107F probably damaging Het
Ldlr T A 9: 21,745,907 probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrrc37a A T 11: 103,498,240 S2120T unknown Het
Mtfmt G T 9: 65,439,615 V164F probably damaging Het
Nampt T C 12: 32,833,038 V74A probably damaging Het
Ndufc2 G T 7: 97,407,664 R120L probably damaging Het
Neo1 A T 9: 58,893,911 V1156D possibly damaging Het
Nlrp1b G A 11: 71,160,072 P1065S possibly damaging Het
Nop9 A G 14: 55,745,940 H56R possibly damaging Het
Olfr1287 A T 2: 111,449,589 T150S probably benign Het
Olfr790 A T 10: 129,501,309 M142L possibly damaging Het
Pign A T 1: 105,522,073 N909K possibly damaging Het
Prex1 A G 2: 166,572,963 V304A probably benign Het
Racgap1 G A 15: 99,628,762 R307W probably damaging Het
Rap1gds1 C A 3: 138,955,420 E399* probably null Het
Rwdd4a G A 8: 47,542,802 probably null Het
Scp2 T C 4: 108,071,291 T401A probably benign Het
Sdha A G 13: 74,327,333 F526S probably damaging Het
Shroom1 T A 11: 53,464,045 L264Q probably benign Het
Sorl1 T C 9: 41,996,294 T1466A probably benign Het
Trpm2 C T 10: 77,966,018 C71Y probably damaging Het
Ugt2b34 G A 5: 86,904,387 S250L probably benign Het
Vmn2r88 A G 14: 51,413,181 D117G probably benign Het
Wdr73 A T 7: 80,892,425 probably benign Het
Other mutations in Gcfc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Gcfc2 APN 6 81936015 missense probably damaging 0.99
IGL00473:Gcfc2 APN 6 81944374 missense probably damaging 1.00
IGL00497:Gcfc2 APN 6 81957970 missense probably benign 0.08
IGL02135:Gcfc2 APN 6 81941400 missense probably damaging 1.00
R0138:Gcfc2 UTSW 6 81949954 missense probably damaging 1.00
R0208:Gcfc2 UTSW 6 81943463 missense probably null 0.91
R0467:Gcfc2 UTSW 6 81923882 missense possibly damaging 0.56
R1105:Gcfc2 UTSW 6 81939453 missense probably damaging 1.00
R1521:Gcfc2 UTSW 6 81923812 missense probably benign 0.14
R1602:Gcfc2 UTSW 6 81944420 missense probably damaging 1.00
R1846:Gcfc2 UTSW 6 81956892 missense probably damaging 0.99
R2091:Gcfc2 UTSW 6 81943479 missense probably damaging 1.00
R2110:Gcfc2 UTSW 6 81923778 missense probably benign 0.01
R2111:Gcfc2 UTSW 6 81923778 missense probably benign 0.01
R2112:Gcfc2 UTSW 6 81923778 missense probably benign 0.01
R2892:Gcfc2 UTSW 6 81956913 missense possibly damaging 0.87
R3792:Gcfc2 UTSW 6 81930767 missense probably benign 0.00
R4284:Gcfc2 UTSW 6 81941391 missense probably damaging 1.00
R4304:Gcfc2 UTSW 6 81943007 missense probably damaging 1.00
R4691:Gcfc2 UTSW 6 81941427 nonsense probably null
R5233:Gcfc2 UTSW 6 81953290 missense probably damaging 1.00
R5307:Gcfc2 UTSW 6 81944386 missense probably damaging 0.97
R5308:Gcfc2 UTSW 6 81943543 critical splice donor site probably null
R5929:Gcfc2 UTSW 6 81946599 missense probably damaging 1.00
R6339:Gcfc2 UTSW 6 81946496 missense probably damaging 1.00
R6485:Gcfc2 UTSW 6 81939547 missense probably damaging 1.00
R6931:Gcfc2 UTSW 6 81942985 missense probably benign 0.36
R6948:Gcfc2 UTSW 6 81933753 missense probably benign 0.01
R7392:Gcfc2 UTSW 6 81943012 critical splice donor site probably null
R7423:Gcfc2 UTSW 6 81946560 missense probably damaging 1.00
R7509:Gcfc2 UTSW 6 81953275 missense probably damaging 1.00
R7713:Gcfc2 UTSW 6 81941390 missense probably damaging 1.00
R8089:Gcfc2 UTSW 6 81925790 missense probably damaging 1.00
R8249:Gcfc2 UTSW 6 81956951 missense probably benign 0.02
R8366:Gcfc2 UTSW 6 81923801 missense probably benign 0.05
R8553:Gcfc2 UTSW 6 81935963 missense probably benign 0.01
R8560:Gcfc2 UTSW 6 81923882 missense possibly damaging 0.56
R8779:Gcfc2 UTSW 6 81948317 missense probably benign 0.00
R8915:Gcfc2 UTSW 6 81941366 missense probably benign 0.36
R8924:Gcfc2 UTSW 6 81932898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCACATGCAAATAGTGTCATGATG -3'
(R):5'- TGACTTTCTAGGTAATATCTCCACGC -3'

Sequencing Primer
(F):5'- GATGAGCCATGGATTTAACCTTACC -3'
(R):5'- CGCAATAGAATCTGAGCATGC -3'
Posted On2016-06-15