Incidental Mutation 'R5046:Wdr73'
ID 394371
Institutional Source Beutler Lab
Gene Symbol Wdr73
Ensembl Gene ENSMUSG00000025722
Gene Name WD repeat domain 73
Synonyms 2410008B13Rik, 1200011I23Rik
MMRRC Submission 042636-MU
Accession Numbers

Genbank: NM_028026; MGI: 1919218

Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock # R5046 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 80890723-80901269 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to T at 80892425 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000026816]
AlphaFold Q9CWR1
Predicted Effect probably benign
Transcript: ENSMUST00000026816
SMART Domains Protein: ENSMUSP00000026816
Gene: ENSMUSG00000025722

DomainStartEndE-ValueType
WD40 67 112 8.52e1 SMART
Blast:WD40 162 204 3e-6 BLAST
Blast:WD40 208 254 3e-17 BLAST
WD40 263 304 2.57e0 SMART
WD40 314 364 8.91e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139990
Predicted Effect probably benign
Transcript: ENSMUST00000146402
SMART Domains Protein: ENSMUSP00000119974
Gene: ENSMUSG00000025722

DomainStartEndE-ValueType
Blast:WD40 66 111 3e-26 BLAST
Blast:WD40 182 228 4e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152518
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain multiple WD40 repeats. WD40 repeats are motifs that contain 40-60 amino acids, and usually end with Trp-Asp (WD). This protein is found in the cytoplasm during interphase, but accumulates at the spindle poles and astral microtubules during mitosis. Reduced expression of this gene results in abnormalities in the size and morphology of the nucleus. Mutations in this gene have been associated with Galloway-Mowat syndrome PMID: 25466283), which is a rare autosomal recessive disorder that affects both the central nervous system and kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,620,354 M182R probably benign Het
Acsm4 C A 7: 119,703,374 H241N probably damaging Het
Arhgap32 G A 9: 32,256,799 A693T probably damaging Het
B4galnt3 G T 6: 120,214,798 A658D probably damaging Het
Car12 G A 9: 66,746,613 E84K probably benign Het
Crocc2 T A 1: 93,205,902 S969T probably damaging Het
Crym A G 7: 120,195,444 V184A possibly damaging Het
Cryzl2 T C 1: 157,465,013 C122R probably damaging Het
Defb30 T C 14: 63,036,014 E49G probably benign Het
Dnah3 A G 7: 119,951,580 L3161P probably damaging Het
Dnajc5g A G 5: 31,109,692 N104S probably benign Het
Fcgr1 T G 3: 96,286,986 K195T probably damaging Het
Gal C T 19: 3,411,167 R89H probably damaging Het
Gcfc2 C T 6: 81,948,335 A577V probably benign Het
Gm5116 A C 7: 32,495,954 noncoding transcript Het
Golga3 A T 5: 110,192,940 Q540L probably damaging Het
Hectd1 T C 12: 51,750,388 E2184G probably damaging Het
Hspa12a T C 19: 58,799,545 D615G probably damaging Het
Igkv14-130 A T 6: 67,791,481 Y107F probably damaging Het
Ldlr T A 9: 21,745,907 probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrrc37a A T 11: 103,498,240 S2120T unknown Het
Mtfmt G T 9: 65,439,615 V164F probably damaging Het
Nampt T C 12: 32,833,038 V74A probably damaging Het
Ndufc2 G T 7: 97,407,664 R120L probably damaging Het
Neo1 A T 9: 58,893,911 V1156D possibly damaging Het
Nlrp1b G A 11: 71,160,072 P1065S possibly damaging Het
Nop9 A G 14: 55,745,940 H56R possibly damaging Het
Olfr1287 A T 2: 111,449,589 T150S probably benign Het
Olfr790 A T 10: 129,501,309 M142L possibly damaging Het
Pign A T 1: 105,522,073 N909K possibly damaging Het
Prex1 A G 2: 166,572,963 V304A probably benign Het
Racgap1 G A 15: 99,628,762 R307W probably damaging Het
Rap1gds1 C A 3: 138,955,420 E399* probably null Het
Rwdd4a G A 8: 47,542,802 probably null Het
Scp2 T C 4: 108,071,291 T401A probably benign Het
Sdha A G 13: 74,327,333 F526S probably damaging Het
Shroom1 T A 11: 53,464,045 L264Q probably benign Het
Sorl1 T C 9: 41,996,294 T1466A probably benign Het
Trpm2 C T 10: 77,966,018 C71Y probably damaging Het
Ugt2b34 G A 5: 86,904,387 S250L probably benign Het
Vmn2r88 A G 14: 51,413,181 D117G probably benign Het
Other mutations in Wdr73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Wdr73 APN 7 80893663 missense probably benign 0.01
IGL02183:Wdr73 APN 7 80893760 missense probably damaging 1.00
IGL03253:Wdr73 APN 7 80897946 missense probably benign 0.00
3-1:Wdr73 UTSW 7 80897959 missense possibly damaging 0.91
R0469:Wdr73 UTSW 7 80897950 nonsense probably null
R0507:Wdr73 UTSW 7 80891846 missense possibly damaging 0.88
R0510:Wdr73 UTSW 7 80897950 nonsense probably null
R1349:Wdr73 UTSW 7 80893252 missense probably damaging 1.00
R1782:Wdr73 UTSW 7 80891778 missense probably damaging 1.00
R1917:Wdr73 UTSW 7 80893333 missense probably benign 0.17
R3085:Wdr73 UTSW 7 80901242 unclassified probably benign
R4478:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4479:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4480:Wdr73 UTSW 7 80893221 missense probably benign 0.06
R4910:Wdr73 UTSW 7 80891708 missense probably damaging 0.97
R4925:Wdr73 UTSW 7 80893195 missense probably benign 0.00
R5286:Wdr73 UTSW 7 80891809 missense probably benign 0.04
R5842:Wdr73 UTSW 7 80891710 missense probably damaging 1.00
R6991:Wdr73 UTSW 7 80891856 missense probably benign 0.17
R7182:Wdr73 UTSW 7 80893678 missense possibly damaging 0.45
R7197:Wdr73 UTSW 7 80893198 missense probably benign 0.02
R7362:Wdr73 UTSW 7 80900703 missense probably damaging 1.00
R7771:Wdr73 UTSW 7 80893227 missense probably benign 0.13
R8558:Wdr73 UTSW 7 80898506 missense probably damaging 1.00
R8950:Wdr73 UTSW 7 80900383 missense probably benign 0.00
X0022:Wdr73 UTSW 7 80897951 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GGTAGTTGTACAGGCCTGAG -3'
(R):5'- TTCCAGGATCCAGAGAGAACAG -3'

Sequencing Primer
(F):5'- ATTGTCCAGGCACAGTGTAC -3'
(R):5'- TCCAGAGAGAACAGGAGGAC -3'
Posted On 2016-06-15