Incidental Mutation 'R5046:Acsm4'
ID 394373
Institutional Source Beutler Lab
Gene Symbol Acsm4
Ensembl Gene ENSMUSG00000047026
Gene Name acyl-CoA synthetase medium-chain family member 4
Synonyms OMACS, O-MACS
MMRRC Submission 042636-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R5046 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 119289249-119313788 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 119302597 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 241 (H241N)
Ref Sequence ENSEMBL: ENSMUSP00000045160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047045]
AlphaFold Q80W40
Predicted Effect probably damaging
Transcript: ENSMUST00000047045
AA Change: H241N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045160
Gene: ENSMUSG00000047026
AA Change: H241N

DomainStartEndE-ValueType
Pfam:AMP-binding 64 478 5.8e-83 PFAM
Pfam:AMP-binding_C 486 566 1.4e-22 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap32 G A 9: 32,168,095 (GRCm39) A693T probably damaging Het
B4galnt3 G T 6: 120,191,759 (GRCm39) A658D probably damaging Het
Car12 G A 9: 66,653,895 (GRCm39) E84K probably benign Het
Crocc2 T A 1: 93,133,624 (GRCm39) S969T probably damaging Het
Crym A G 7: 119,794,667 (GRCm39) V184A possibly damaging Het
Cryzl2 T C 1: 157,292,583 (GRCm39) C122R probably damaging Het
Defb30 T C 14: 63,273,463 (GRCm39) E49G probably benign Het
Dnah3 A G 7: 119,550,803 (GRCm39) L3161P probably damaging Het
Dnajc5g A G 5: 31,267,036 (GRCm39) N104S probably benign Het
Fcgr1 T G 3: 96,194,302 (GRCm39) K195T probably damaging Het
Gal C T 19: 3,461,167 (GRCm39) R89H probably damaging Het
Gcfc2 C T 6: 81,925,316 (GRCm39) A577V probably benign Het
Gm5116 A C 7: 32,195,379 (GRCm39) noncoding transcript Het
Golga3 A T 5: 110,340,806 (GRCm39) Q540L probably damaging Het
Hectd1 T C 12: 51,797,171 (GRCm39) E2184G probably damaging Het
Hspa12a T C 19: 58,787,977 (GRCm39) D615G probably damaging Het
Igkv14-130 A T 6: 67,768,465 (GRCm39) Y107F probably damaging Het
Ldlr T A 9: 21,657,203 (GRCm39) probably null Het
Lin9 T A 1: 180,496,763 (GRCm39) L351I probably benign Het
Lrrc37a A T 11: 103,389,066 (GRCm39) S2120T unknown Het
Mtfmt G T 9: 65,346,897 (GRCm39) V164F probably damaging Het
Nampt T C 12: 32,883,037 (GRCm39) V74A probably damaging Het
Ndufc2 G T 7: 97,056,871 (GRCm39) R120L probably damaging Het
Neo1 A T 9: 58,801,194 (GRCm39) V1156D possibly damaging Het
Nlrp1b G A 11: 71,050,898 (GRCm39) P1065S possibly damaging Het
Nop9 A G 14: 55,983,397 (GRCm39) H56R possibly damaging Het
Or4k41 A T 2: 111,279,934 (GRCm39) T150S probably benign Het
Or6c75 A T 10: 129,337,178 (GRCm39) M142L possibly damaging Het
Pign A T 1: 105,449,798 (GRCm39) N909K possibly damaging Het
Prex1 A G 2: 166,414,883 (GRCm39) V304A probably benign Het
Racgap1 G A 15: 99,526,643 (GRCm39) R307W probably damaging Het
Rap1gds1 C A 3: 138,661,181 (GRCm39) E399* probably null Het
Rwdd4a G A 8: 47,995,837 (GRCm39) probably null Het
Sanbr A C 11: 23,570,354 (GRCm39) M182R probably benign Het
Scp2 T C 4: 107,928,488 (GRCm39) T401A probably benign Het
Sdha A G 13: 74,475,452 (GRCm39) F526S probably damaging Het
Shroom1 T A 11: 53,354,872 (GRCm39) L264Q probably benign Het
Sorl1 T C 9: 41,907,590 (GRCm39) T1466A probably benign Het
Trpm2 C T 10: 77,801,852 (GRCm39) C71Y probably damaging Het
Ugt2b34 G A 5: 87,052,246 (GRCm39) S250L probably benign Het
Vmn2r88 A G 14: 51,650,638 (GRCm39) D117G probably benign Het
Wdr73 A T 7: 80,542,173 (GRCm39) probably benign Het
Other mutations in Acsm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Acsm4 APN 7 119,310,642 (GRCm39) nonsense probably null
IGL01676:Acsm4 APN 7 119,307,866 (GRCm39) missense probably benign 0.00
IGL01801:Acsm4 APN 7 119,306,486 (GRCm39) missense possibly damaging 0.80
IGL02183:Acsm4 APN 7 119,293,075 (GRCm39) splice site probably null
IGL02220:Acsm4 APN 7 119,310,395 (GRCm39) missense probably damaging 1.00
IGL02637:Acsm4 APN 7 119,309,907 (GRCm39) missense probably damaging 1.00
IGL03290:Acsm4 APN 7 119,302,646 (GRCm39) splice site probably benign
I0000:Acsm4 UTSW 7 119,310,415 (GRCm39) missense probably damaging 1.00
PIT4382001:Acsm4 UTSW 7 119,297,798 (GRCm39) missense probably damaging 1.00
R1068:Acsm4 UTSW 7 119,307,933 (GRCm39) missense probably benign 0.00
R1386:Acsm4 UTSW 7 119,297,801 (GRCm39) missense probably benign
R1433:Acsm4 UTSW 7 119,293,042 (GRCm39) missense probably damaging 0.99
R1961:Acsm4 UTSW 7 119,307,963 (GRCm39) missense probably benign 0.04
R3957:Acsm4 UTSW 7 119,302,588 (GRCm39) missense possibly damaging 0.93
R4029:Acsm4 UTSW 7 119,293,008 (GRCm39) missense probably benign
R4072:Acsm4 UTSW 7 119,297,981 (GRCm39) missense probably benign 0.14
R4075:Acsm4 UTSW 7 119,297,981 (GRCm39) missense probably benign 0.14
R4076:Acsm4 UTSW 7 119,297,981 (GRCm39) missense probably benign 0.14
R4432:Acsm4 UTSW 7 119,310,610 (GRCm39) missense probably damaging 1.00
R4452:Acsm4 UTSW 7 119,297,797 (GRCm39) missense possibly damaging 0.92
R4757:Acsm4 UTSW 7 119,297,900 (GRCm39) missense probably benign
R4992:Acsm4 UTSW 7 119,310,640 (GRCm39) missense probably benign 0.43
R5473:Acsm4 UTSW 7 119,312,173 (GRCm39) missense probably damaging 1.00
R5662:Acsm4 UTSW 7 119,294,023 (GRCm39) missense possibly damaging 0.49
R5780:Acsm4 UTSW 7 119,293,068 (GRCm39) missense possibly damaging 0.66
R6957:Acsm4 UTSW 7 119,310,622 (GRCm39) missense probably damaging 1.00
R7579:Acsm4 UTSW 7 119,292,933 (GRCm39) missense probably benign 0.01
R7892:Acsm4 UTSW 7 119,293,889 (GRCm39) missense possibly damaging 0.48
R8716:Acsm4 UTSW 7 119,307,883 (GRCm39) missense probably damaging 1.00
R8738:Acsm4 UTSW 7 119,304,264 (GRCm39) missense probably benign 0.00
R9616:Acsm4 UTSW 7 119,293,872 (GRCm39) missense probably benign 0.01
Z1177:Acsm4 UTSW 7 119,310,594 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACCCTAGTAGAGAACAATCATAC -3'
(R):5'- CCTGGGAGACTGCATAGAAAAC -3'

Sequencing Primer
(F):5'- TCATACAGAGTCAACTGATCTCC -3'
(R):5'- CCTGCAAATTCAACTATTTTTGTGGG -3'
Posted On 2016-06-15