Incidental Mutation 'R5046:Trpm2'
ID 394382
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Name transient receptor potential cation channel, subfamily M, member 2
Synonyms LTRPC2, 9830168K16Rik, TRPC7, Trrp7
MMRRC Submission 042636-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R5046 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 77907722-77970563 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 77966018 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 71 (C71Y)
Ref Sequence ENSEMBL: ENSMUSP00000151231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105399] [ENSMUST00000105401] [ENSMUST00000219997]
AlphaFold Q91YD4
Predicted Effect probably damaging
Transcript: ENSMUST00000105399
AA Change: C71Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101038
Gene: ENSMUSG00000009292
AA Change: C71Y

DomainStartEndE-ValueType
low complexity region 88 96 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105400
Predicted Effect probably damaging
Transcript: ENSMUST00000105401
AA Change: C71Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: C71Y

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154996
Predicted Effect probably damaging
Transcript: ENSMUST00000219997
AA Change: C71Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9509 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,620,354 M182R probably benign Het
Acsm4 C A 7: 119,703,374 H241N probably damaging Het
Arhgap32 G A 9: 32,256,799 A693T probably damaging Het
B4galnt3 G T 6: 120,214,798 A658D probably damaging Het
Car12 G A 9: 66,746,613 E84K probably benign Het
Crocc2 T A 1: 93,205,902 S969T probably damaging Het
Crym A G 7: 120,195,444 V184A possibly damaging Het
Cryzl2 T C 1: 157,465,013 C122R probably damaging Het
Defb30 T C 14: 63,036,014 E49G probably benign Het
Dnah3 A G 7: 119,951,580 L3161P probably damaging Het
Dnajc5g A G 5: 31,109,692 N104S probably benign Het
Fcgr1 T G 3: 96,286,986 K195T probably damaging Het
Gal C T 19: 3,411,167 R89H probably damaging Het
Gcfc2 C T 6: 81,948,335 A577V probably benign Het
Gm5116 A C 7: 32,495,954 noncoding transcript Het
Golga3 A T 5: 110,192,940 Q540L probably damaging Het
Hectd1 T C 12: 51,750,388 E2184G probably damaging Het
Hspa12a T C 19: 58,799,545 D615G probably damaging Het
Igkv14-130 A T 6: 67,791,481 Y107F probably damaging Het
Ldlr T A 9: 21,745,907 probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrrc37a A T 11: 103,498,240 S2120T unknown Het
Mtfmt G T 9: 65,439,615 V164F probably damaging Het
Nampt T C 12: 32,833,038 V74A probably damaging Het
Ndufc2 G T 7: 97,407,664 R120L probably damaging Het
Neo1 A T 9: 58,893,911 V1156D possibly damaging Het
Nlrp1b G A 11: 71,160,072 P1065S possibly damaging Het
Nop9 A G 14: 55,745,940 H56R possibly damaging Het
Olfr1287 A T 2: 111,449,589 T150S probably benign Het
Olfr790 A T 10: 129,501,309 M142L possibly damaging Het
Pign A T 1: 105,522,073 N909K possibly damaging Het
Prex1 A G 2: 166,572,963 V304A probably benign Het
Racgap1 G A 15: 99,628,762 R307W probably damaging Het
Rap1gds1 C A 3: 138,955,420 E399* probably null Het
Rwdd4a G A 8: 47,542,802 probably null Het
Scp2 T C 4: 108,071,291 T401A probably benign Het
Sdha A G 13: 74,327,333 F526S probably damaging Het
Shroom1 T A 11: 53,464,045 L264Q probably benign Het
Sorl1 T C 9: 41,996,294 T1466A probably benign Het
Ugt2b34 G A 5: 86,904,387 S250L probably benign Het
Vmn2r88 A G 14: 51,413,181 D117G probably benign Het
Wdr73 A T 7: 80,892,425 probably benign Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77942915 splice site probably null
IGL00773:Trpm2 APN 10 77949214 nonsense probably null
IGL00962:Trpm2 APN 10 77943916 splice site probably benign
IGL01093:Trpm2 APN 10 77932280 missense probably benign 0.04
IGL01124:Trpm2 APN 10 77945825 splice site probably benign
IGL01301:Trpm2 APN 10 77923984 missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77942996 nonsense probably null
IGL02175:Trpm2 APN 10 77937907 missense probably benign 0.07
IGL02653:Trpm2 APN 10 77912669 missense probably benign 0.19
IGL02667:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77918986 missense probably benign 0.16
IGL02951:Trpm2 APN 10 77929278 missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77918909 missense probably benign 0.18
IGL03242:Trpm2 APN 10 77917734 missense probably benign
IGL03405:Trpm2 APN 10 77966072 splice site probably benign
Fugit UTSW 10 77938368 missense probably damaging 1.00
scusate UTSW 10 77966994 nonsense probably null
temporal UTSW 10 77925682 missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77923984 missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77943990 splice site probably benign
R0332:Trpm2 UTSW 10 77947988 missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77923516 missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77929288 missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77923564 missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77966994 nonsense probably null
R1518:Trpm2 UTSW 10 77943005 missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77942999 missense probably benign 0.14
R1593:Trpm2 UTSW 10 77943076 missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77935875 splice site probably null
R1673:Trpm2 UTSW 10 77942944 missense probably benign
R1912:Trpm2 UTSW 10 77945876 missense probably benign 0.10
R1932:Trpm2 UTSW 10 77941158 missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77947989 missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77925766 missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R2201:Trpm2 UTSW 10 77920471 nonsense probably null
R2217:Trpm2 UTSW 10 77941182 missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77918964 missense probably benign 0.04
R2339:Trpm2 UTSW 10 77914806 splice site probably benign
R2395:Trpm2 UTSW 10 77947880 missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77930637 missense probably benign 0.14
R2405:Trpm2 UTSW 10 77934724 missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77941174 missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3002:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3125:Trpm2 UTSW 10 77911374 missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77932302 missense probably benign 0.03
R3777:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R3778:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R4272:Trpm2 UTSW 10 77933642 missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77917725 missense probably benign 0.44
R4395:Trpm2 UTSW 10 77929219 missense probably benign 0.01
R4423:Trpm2 UTSW 10 77935068 missense probably benign 0.00
R4452:Trpm2 UTSW 10 77923593 missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77945916 missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77938138 missense probably benign 0.05
R4825:Trpm2 UTSW 10 77941173 missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77932189 nonsense probably null
R4943:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77917792 missense probably benign 0.34
R5320:Trpm2 UTSW 10 77923521 missense probably benign 0.06
R5523:Trpm2 UTSW 10 77935961 missense probably benign 0.04
R5562:Trpm2 UTSW 10 77959939 missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77932139 missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77912636 missense probably benign 0.00
R5633:Trpm2 UTSW 10 77938353 missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77965980 missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77959900 missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77917713 missense probably benign 0.00
R6075:Trpm2 UTSW 10 77935043 critical splice donor site probably null
R6092:Trpm2 UTSW 10 77925682 missense probably benign 0.30
R6309:Trpm2 UTSW 10 77938368 missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77932227 missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6579:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6640:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6642:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6798:Trpm2 UTSW 10 77914740 missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77935891 missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77912592 missense probably benign
R7036:Trpm2 UTSW 10 77912592 missense probably benign
R7113:Trpm2 UTSW 10 77947931 missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77924014 missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77935876 critical splice donor site probably null
R7274:Trpm2 UTSW 10 77923555 missense probably benign 0.00
R7379:Trpm2 UTSW 10 77914734 missense probably benign
R7527:Trpm2 UTSW 10 77966060 missense probably benign 0.01
R7571:Trpm2 UTSW 10 77937950 missense probably benign 0.21
R7600:Trpm2 UTSW 10 77938051 missense probably benign 0.02
R7727:Trpm2 UTSW 10 77925789 missense probably benign 0.34
R7771:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R7844:Trpm2 UTSW 10 77923506 missense probably benign 0.00
R8158:Trpm2 UTSW 10 77947897 missense probably damaging 0.99
R8225:Trpm2 UTSW 10 77947973 missense probably damaging 1.00
R8226:Trpm2 UTSW 10 77947973 missense probably damaging 1.00
R8239:Trpm2 UTSW 10 77936002 missense probably benign 0.06
R8275:Trpm2 UTSW 10 77966025 nonsense probably null
R8340:Trpm2 UTSW 10 77923624 nonsense probably null
R8354:Trpm2 UTSW 10 77933649 missense probably damaging 1.00
R8427:Trpm2 UTSW 10 77911402 missense possibly damaging 0.93
R8445:Trpm2 UTSW 10 77910252 missense probably damaging 1.00
R8769:Trpm2 UTSW 10 77932294 missense probably benign 0.00
R9144:Trpm2 UTSW 10 77929288 missense probably benign 0.01
R9286:Trpm2 UTSW 10 77941180 missense probably benign 0.06
R9319:Trpm2 UTSW 10 77942942 nonsense probably null
R9319:Trpm2 UTSW 10 77949198 missense probably damaging 1.00
R9381:Trpm2 UTSW 10 77911357 missense possibly damaging 0.90
R9457:Trpm2 UTSW 10 77911392 missense possibly damaging 0.82
R9477:Trpm2 UTSW 10 77911390 missense probably benign 0.12
R9547:Trpm2 UTSW 10 77912633 missense probably benign 0.33
R9660:Trpm2 UTSW 10 77930555 missense probably benign 0.00
R9663:Trpm2 UTSW 10 77920486 missense probably benign 0.01
Z1177:Trpm2 UTSW 10 77937868 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATTGGGGATTCTCAGCCTGG -3'
(R):5'- TCACACAGGCTCATCCTTG -3'

Sequencing Primer
(F):5'- ATTCTCAGCCTGGCATGGACAC -3'
(R):5'- TGTCTCCTGGGCACACAC -3'
Posted On 2016-06-15