Mutagenetix > Incidental Mutations

Incidental Mutation 'R5046:Trpm2'

394382

Institutional Source

Beutler Lab

Gene Symbol

Trpm2

Ensembl Gene

ENSMUSG00000009292

Gene Name

transient receptor potential cation channel, subfamily M, member 2

Synonyms

LTRPC2, 9830168K16Rik, TRPC7, Trrp7

MMRRC Submission

042636-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.119) question?

Stock #

R5046 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77907722-77970563 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 77966018 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 71 (C71Y)

Ref Sequence

ENSEMBL: ENSMUSP00000151231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105399] [ENSMUST00000105401] [ENSMUST00000219997]

Predicted Effect

probably damaging
Transcript: ENSMUST00000105399
AA Change: C71Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000101038
Gene: ENSMUSG00000009292
AA Change: C71Y

Domain	Start	End	E-Value	Type
low complexity region	88	96	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000105400

Predicted Effect

probably damaging
Transcript: ENSMUST00000105401
AA Change: C71Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: C71Y

Domain	Start	End	E-Value	Type
low complexity region	654	672	N/A	INTRINSIC
transmembrane domain	750	772	N/A	INTRINSIC
Pfam:Ion_trans	794	1057	3.7e-21	PFAM
low complexity region	1078	1090	N/A	INTRINSIC
low complexity region	1106	1115	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC
PDB:1QVJ\|A	1236	1506	3e-37	PDB
SCOP:d1k2ea_	1369	1502	9e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154996

Predicted Effect

probably damaging
Transcript: ENSMUST00000219997
AA Change: C71Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.9509

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,620,354	M182R	probably benign	Het
Acsm4	C	A	7: 119,703,374	H241N	probably damaging	Het
Arhgap32	G	A	9: 32,256,799	A693T	probably damaging	Het
B4galnt3	G	T	6: 120,214,798	A658D	probably damaging	Het
Car12	G	A	9: 66,746,613	E84K	probably benign	Het
Crocc2	T	A	1: 93,205,902	S969T	probably damaging	Het
Crym	A	G	7: 120,195,444	V184A	possibly damaging	Het
Cryzl2	T	C	1: 157,465,013	C122R	probably damaging	Het
Defb30	T	C	14: 63,036,014	E49G	probably benign	Het
Dnah3	A	G	7: 119,951,580	L3161P	probably damaging	Het
Dnajc5g	A	G	5: 31,109,692	N104S	probably benign	Het
Fcgr1	T	G	3: 96,286,986	K195T	probably damaging	Het
Gal	C	T	19: 3,411,167	R89H	probably damaging	Het
Gcfc2	C	T	6: 81,948,335	A577V	probably benign	Het
Gm5116	A	C	7: 32,495,954		noncoding transcript	Het
Golga3	A	T	5: 110,192,940	Q540L	probably damaging	Het
Hectd1	T	C	12: 51,750,388	E2184G	probably damaging	Het
Hspa12a	T	C	19: 58,799,545	D615G	probably damaging	Het
Igkv14-130	A	T	6: 67,791,481	Y107F	probably damaging	Het
Ldlr	T	A	9: 21,745,907		probably null	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Lrrc37a	A	T	11: 103,498,240	S2120T	unknown	Het
Mtfmt	G	T	9: 65,439,615	V164F	probably damaging	Het
Nampt	T	C	12: 32,833,038	V74A	probably damaging	Het
Ndufc2	G	T	7: 97,407,664	R120L	probably damaging	Het
Neo1	A	T	9: 58,893,911	V1156D	possibly damaging	Het
Nlrp1b	G	A	11: 71,160,072	P1065S	possibly damaging	Het
Nop9	A	G	14: 55,745,940	H56R	possibly damaging	Het
Olfr1287	A	T	2: 111,449,589	T150S	probably benign	Het
Olfr790	A	T	10: 129,501,309	M142L	possibly damaging	Het
Pign	A	T	1: 105,522,073	N909K	possibly damaging	Het
Prex1	A	G	2: 166,572,963	V304A	probably benign	Het
Racgap1	G	A	15: 99,628,762	R307W	probably damaging	Het
Rap1gds1	C	A	3: 138,955,420	E399*	probably null	Het
Rwdd4a	G	A	8: 47,542,802		probably null	Het
Scp2	T	C	4: 108,071,291	T401A	probably benign	Het
Sdha	A	G	13: 74,327,333	F526S	probably damaging	Het
Shroom1	T	A	11: 53,464,045	L264Q	probably benign	Het
Sorl1	T	C	9: 41,996,294	T1466A	probably benign	Het
Ugt2b34	G	A	5: 86,904,387	S250L	probably benign	Het
Vmn2r88	A	G	14: 51,413,181	D117G	probably benign	Het
Wdr73	A	T	7: 80,892,425		probably benign	Het

Other mutations in Trpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00730:Trpm2	APN	10	77942915	splice site	probably null
IGL00773:Trpm2	APN	10	77949214	nonsense	probably null
IGL00962:Trpm2	APN	10	77943916	splice site	probably benign
IGL01093:Trpm2	APN	10	77932280	missense	probably benign	0.04
IGL01124:Trpm2	APN	10	77945825	splice site	probably benign
IGL01301:Trpm2	APN	10	77923984	missense	probably damaging	1.00
IGL02094:Trpm2	APN	10	77942996	nonsense	probably null
IGL02175:Trpm2	APN	10	77937907	missense	probably benign	0.07
IGL02653:Trpm2	APN	10	77912669	missense	probably benign	0.19
IGL02667:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02668:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02828:Trpm2	APN	10	77918986	missense	probably benign	0.16
IGL02951:Trpm2	APN	10	77929278	missense	possibly damaging	0.95
IGL03188:Trpm2	APN	10	77918909	missense	probably benign	0.18
IGL03242:Trpm2	APN	10	77917734	missense	probably benign
IGL03405:Trpm2	APN	10	77966072	splice site	probably benign
Fugit	UTSW	10	77938368	missense	probably damaging	1.00
scusate	UTSW	10	77966994	nonsense	probably null
temporal	UTSW	10	77925682	missense	probably benign	0.30
ANU18:Trpm2	UTSW	10	77923984	missense	probably damaging	1.00
R0147:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0148:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0302:Trpm2	UTSW	10	77943990	splice site	probably benign
R0332:Trpm2	UTSW	10	77947988	missense	probably damaging	1.00
R0586:Trpm2	UTSW	10	77923516	missense	probably damaging	0.99
R0847:Trpm2	UTSW	10	77929288	missense	possibly damaging	0.94
R1183:Trpm2	UTSW	10	77923564	missense	probably damaging	1.00
R1472:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R1510:Trpm2	UTSW	10	77966994	nonsense	probably null
R1518:Trpm2	UTSW	10	77943005	missense	possibly damaging	0.67
R1564:Trpm2	UTSW	10	77942999	missense	probably benign	0.14
R1593:Trpm2	UTSW	10	77943076	missense	possibly damaging	0.71
R1617:Trpm2	UTSW	10	77935875	splice site	probably null
R1673:Trpm2	UTSW	10	77942944	missense	probably benign
R1912:Trpm2	UTSW	10	77945876	missense	probably benign	0.10
R1932:Trpm2	UTSW	10	77941158	missense	probably damaging	1.00
R1993:Trpm2	UTSW	10	77947989	missense	probably damaging	1.00
R2013:Trpm2	UTSW	10	77925766	missense	probably damaging	1.00
R2151:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R2201:Trpm2	UTSW	10	77920471	nonsense	probably null
R2217:Trpm2	UTSW	10	77941182	missense	probably damaging	1.00
R2312:Trpm2	UTSW	10	77918964	missense	probably benign	0.04
R2339:Trpm2	UTSW	10	77914806	splice site	probably benign
R2395:Trpm2	UTSW	10	77947880	missense	possibly damaging	0.69
R2396:Trpm2	UTSW	10	77930637	missense	probably benign	0.14
R2405:Trpm2	UTSW	10	77934724	missense	probably damaging	1.00
R2567:Trpm2	UTSW	10	77941174	missense	probably damaging	0.99
R3001:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3002:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3125:Trpm2	UTSW	10	77911374	missense	probably damaging	1.00
R3500:Trpm2	UTSW	10	77932302	missense	probably benign	0.03
R3777:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R3778:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R4272:Trpm2	UTSW	10	77933642	missense	probably damaging	1.00
R4384:Trpm2	UTSW	10	77917725	missense	probably benign	0.44
R4395:Trpm2	UTSW	10	77929219	missense	probably benign	0.01
R4423:Trpm2	UTSW	10	77935068	missense	probably benign	0.00
R4452:Trpm2	UTSW	10	77923593	missense	probably damaging	1.00
R4612:Trpm2	UTSW	10	77945916	missense	probably damaging	0.99
R4662:Trpm2	UTSW	10	77938138	missense	probably benign	0.05
R4825:Trpm2	UTSW	10	77941173	missense	probably damaging	0.98
R4906:Trpm2	UTSW	10	77932189	nonsense	probably null
R4943:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R4948:Trpm2	UTSW	10	77917792	missense	probably benign	0.34
R5320:Trpm2	UTSW	10	77923521	missense	probably benign	0.06
R5523:Trpm2	UTSW	10	77935961	missense	probably benign	0.04
R5562:Trpm2	UTSW	10	77959939	missense	possibly damaging	0.71
R5623:Trpm2	UTSW	10	77932139	missense	probably damaging	0.96
R5628:Trpm2	UTSW	10	77912636	missense	probably benign	0.00
R5633:Trpm2	UTSW	10	77938353	missense	possibly damaging	0.71
R5817:Trpm2	UTSW	10	77965980	missense	probably damaging	1.00
R5989:Trpm2	UTSW	10	77959900	missense	probably damaging	1.00
R6018:Trpm2	UTSW	10	77917713	missense	probably benign	0.00
R6075:Trpm2	UTSW	10	77935043	critical splice donor site	probably null
R6092:Trpm2	UTSW	10	77925682	missense	probably benign	0.30
R6309:Trpm2	UTSW	10	77938368	missense	probably damaging	1.00
R6327:Trpm2	UTSW	10	77932227	missense	probably damaging	1.00
R6568:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6579:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6640:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6642:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6798:Trpm2	UTSW	10	77914740	missense	probably damaging	0.99
R6999:Trpm2	UTSW	10	77935891	missense	probably damaging	1.00
R7034:Trpm2	UTSW	10	77912592	missense	probably benign
R7036:Trpm2	UTSW	10	77912592	missense	probably benign
R7113:Trpm2	UTSW	10	77947931	missense	probably damaging	0.96
R7171:Trpm2	UTSW	10	77924014	missense	probably damaging	1.00
R7240:Trpm2	UTSW	10	77935876	critical splice donor site	probably null
R7274:Trpm2	UTSW	10	77923555	missense	probably benign	0.00
R7379:Trpm2	UTSW	10	77914734	missense	probably benign
R7527:Trpm2	UTSW	10	77966060	missense	probably benign	0.01
R7571:Trpm2	UTSW	10	77937950	missense	probably benign	0.21
R7600:Trpm2	UTSW	10	77938051	missense	probably benign	0.02
R7727:Trpm2	UTSW	10	77925789	missense	probably benign	0.34
R7771:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R7844:Trpm2	UTSW	10	77923506	missense	probably benign	0.00
R7927:Trpm2	UTSW	10	77923506	missense	probably benign	0.00
Z1177:Trpm2	UTSW	10	77937868	missense	not run

Predicted Primers

PCR Primer
(F):5'- ATTGGGGATTCTCAGCCTGG -3'
(R):5'- TCACACAGGCTCATCCTTG -3'

Sequencing Primer
(F):5'- ATTCTCAGCCTGGCATGGACAC -3'
(R):5'- TGTCTCCTGGGCACACAC -3'

Posted On

2016-06-15