Mutagenetix > Incidental Mutations

Incidental Mutation 'R5046:Shroom1'

394385

Institutional Source

Beutler Lab

Gene Symbol

Shroom1

Ensembl Gene

ENSMUSG00000018387

Gene Name

shroom family member 1

Synonyms

Shrm1, Apx, 1300007L22Rik

MMRRC Submission

042636-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.112) question?

Stock #

R5046 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53457205-53467766 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 53464045 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 264 (L264Q)

Ref Sequence

ENSEMBL: ENSMUSP00000104641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018531] [ENSMUST00000093114] [ENSMUST00000109013]

Predicted Effect

probably benign
Transcript: ENSMUST00000018531
AA Change: L264Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000018531
Gene: ENSMUSG00000018387
AA Change: L264Q

Domain	Start	End	E-Value	Type
Pfam:ASD1	108	269	1.1e-21	PFAM
low complexity region	410	417	N/A	INTRINSIC
Pfam:ASD2	454	732	4.4e-83	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000093114
AA Change: L264Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000090802
Gene: ENSMUSG00000018387
AA Change: L264Q

Domain	Start	End	E-Value	Type
Pfam:ASD1	108	269	3.7e-22	PFAM
low complexity region	473	480	N/A	INTRINSIC
Pfam:ASD2	517	715	1e-50	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000109010

Predicted Effect

probably benign
Transcript: ENSMUST00000109013
AA Change: L264Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000104641
Gene: ENSMUSG00000018387
AA Change: L264Q

Domain	Start	End	E-Value	Type
Pfam:ASD1	114	269	4.2e-19	PFAM
low complexity region	473	480	N/A	INTRINSIC
Pfam:ASD2	518	795	2.4e-77	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141032

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146001

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155297

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHROOM family members play diverse roles in the development of the nervous system and other tissues (Hagens et al., 2006 [PubMed 16615870]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,620,354	M182R	probably benign	Het
Acsm4	C	A	7: 119,703,374	H241N	probably damaging	Het
Arhgap32	G	A	9: 32,256,799	A693T	probably damaging	Het
B4galnt3	G	T	6: 120,214,798	A658D	probably damaging	Het
Car12	G	A	9: 66,746,613	E84K	probably benign	Het
Crocc2	T	A	1: 93,205,902	S969T	probably damaging	Het
Crym	A	G	7: 120,195,444	V184A	possibly damaging	Het
Cryzl2	T	C	1: 157,465,013	C122R	probably damaging	Het
Defb30	T	C	14: 63,036,014	E49G	probably benign	Het
Dnah3	A	G	7: 119,951,580	L3161P	probably damaging	Het
Dnajc5g	A	G	5: 31,109,692	N104S	probably benign	Het
Fcgr1	T	G	3: 96,286,986	K195T	probably damaging	Het
Gal	C	T	19: 3,411,167	R89H	probably damaging	Het
Gcfc2	C	T	6: 81,948,335	A577V	probably benign	Het
Gm5116	A	C	7: 32,495,954		noncoding transcript	Het
Golga3	A	T	5: 110,192,940	Q540L	probably damaging	Het
Hectd1	T	C	12: 51,750,388	E2184G	probably damaging	Het
Hspa12a	T	C	19: 58,799,545	D615G	probably damaging	Het
Igkv14-130	A	T	6: 67,791,481	Y107F	probably damaging	Het
Ldlr	T	A	9: 21,745,907		probably null	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Lrrc37a	A	T	11: 103,498,240	S2120T	unknown	Het
Mtfmt	G	T	9: 65,439,615	V164F	probably damaging	Het
Nampt	T	C	12: 32,833,038	V74A	probably damaging	Het
Ndufc2	G	T	7: 97,407,664	R120L	probably damaging	Het
Neo1	A	T	9: 58,893,911	V1156D	possibly damaging	Het
Nlrp1b	G	A	11: 71,160,072	P1065S	possibly damaging	Het
Nop9	A	G	14: 55,745,940	H56R	possibly damaging	Het
Olfr1287	A	T	2: 111,449,589	T150S	probably benign	Het
Olfr790	A	T	10: 129,501,309	M142L	possibly damaging	Het
Pign	A	T	1: 105,522,073	N909K	possibly damaging	Het
Prex1	A	G	2: 166,572,963	V304A	probably benign	Het
Racgap1	G	A	15: 99,628,762	R307W	probably damaging	Het
Rap1gds1	C	A	3: 138,955,420	E399*	probably null	Het
Rwdd4a	G	A	8: 47,542,802		probably null	Het
Scp2	T	C	4: 108,071,291	T401A	probably benign	Het
Sdha	A	G	13: 74,327,333	F526S	probably damaging	Het
Sorl1	T	C	9: 41,996,294	T1466A	probably benign	Het
Trpm2	C	T	10: 77,966,018	C71Y	probably damaging	Het
Ugt2b34	G	A	5: 86,904,387	S250L	probably benign	Het
Vmn2r88	A	G	14: 51,413,181	D117G	probably benign	Het
Wdr73	A	T	7: 80,892,425		probably benign	Het

Other mutations in Shroom1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Shroom1	APN	11	53464094	missense	probably benign	0.00
IGL00985:Shroom1	APN	11	53465969	missense	probably benign
IGL01111:Shroom1	APN	11	53464048	missense	probably damaging	0.98
IGL01316:Shroom1	APN	11	53465558	missense	probably damaging	0.99
IGL02512:Shroom1	APN	11	53466559	missense	probably damaging	1.00
IGL03062:Shroom1	APN	11	53463379	missense	probably benign
bracket	UTSW	11	53463982	nonsense	probably null
shitake	UTSW	11	53465722	missense	possibly damaging	0.91
R0083:Shroom1	UTSW	11	53466937	missense	possibly damaging	0.93
R0108:Shroom1	UTSW	11	53466937	missense	possibly damaging	0.93
R0108:Shroom1	UTSW	11	53466937	missense	possibly damaging	0.93
R0242:Shroom1	UTSW	11	53465485	splice site	probably null
R0242:Shroom1	UTSW	11	53465485	splice site	probably null
R0357:Shroom1	UTSW	11	53465208	missense	probably damaging	0.96
R0661:Shroom1	UTSW	11	53466937	missense	possibly damaging	0.93
R1875:Shroom1	UTSW	11	53465675	missense	probably damaging	0.99
R2356:Shroom1	UTSW	11	53466447	missense	probably benign	0.05
R4657:Shroom1	UTSW	11	53465588	missense	possibly damaging	0.79
R4662:Shroom1	UTSW	11	53466462	missense	possibly damaging	0.64
R4690:Shroom1	UTSW	11	53465722	missense	possibly damaging	0.91
R4734:Shroom1	UTSW	11	53465233	missense	probably damaging	1.00
R4820:Shroom1	UTSW	11	53465139	missense	probably benign	0.07
R4964:Shroom1	UTSW	11	53465172	missense	probably benign
R5000:Shroom1	UTSW	11	53467117	utr 3 prime	probably benign
R5141:Shroom1	UTSW	11	53463982	nonsense	probably null
R5256:Shroom1	UTSW	11	53465507	missense	probably benign	0.32
R5273:Shroom1	UTSW	11	53463844	missense	possibly damaging	0.82
R5529:Shroom1	UTSW	11	53463922	missense	probably damaging	1.00
R5762:Shroom1	UTSW	11	53463991	missense	probably benign	0.00
R6058:Shroom1	UTSW	11	53463481	missense	possibly damaging	0.83
R6408:Shroom1	UTSW	11	53463387	missense	probably benign	0.00
R6677:Shroom1	UTSW	11	53463516	missense	possibly damaging	0.85
R7090:Shroom1	UTSW	11	53465933	missense	probably damaging	1.00
R7369:Shroom1	UTSW	11	53465248	missense	probably benign	0.43
R7654:Shroom1	UTSW	11	53466908	missense	probably benign	0.02
R7919:Shroom1	UTSW	11	53463393	missense	probably benign	0.17
R7964:Shroom1	UTSW	11	53464322	missense	possibly damaging	0.94
R8338:Shroom1	UTSW	11	53463280	missense	probably benign	0.08
R8365:Shroom1	UTSW	11	53465641	nonsense	probably null
R8386:Shroom1	UTSW	11	53466403	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGAGTTTCGCATGAGCCTG -3'
(R):5'- AAACAGTCTCCCAGATGCCG -3'

Sequencing Primer
(F):5'- AGTCCCCACGCGACTTC -3'
(R):5'- TCCCCCACCAGTCGACG -3'

Posted On

2016-06-15