Incidental Mutation 'R5046:Hectd1'
ID394389
Institutional Source Beutler Lab
Gene Symbol Hectd1
Ensembl Gene ENSMUSG00000035247
Gene NameHECT domain E3 ubiquitin protein ligase 1
Synonymsb2b327Clo, opm, A630086P08Rik
MMRRC Submission 042636-MU
Accession Numbers

Genbank: NM_144788; MGI: 2384768

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5046 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location51743722-51829536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51750388 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 2184 (E2184G)
Ref Sequence ENSEMBL: ENSMUSP00000046766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042052] [ENSMUST00000179265]
Predicted Effect probably damaging
Transcript: ENSMUST00000042052
AA Change: E2184G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046766
Gene: ENSMUSG00000035247
AA Change: E2184G

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 395 424 1.44e-1 SMART
ANK 426 455 2.81e-4 SMART
ANK 459 488 1.55e2 SMART
low complexity region 490 509 N/A INTRINSIC
low complexity region 630 654 N/A INTRINSIC
low complexity region 707 723 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
Pfam:Sad1_UNC 1107 1240 9.2e-27 PFAM
low complexity region 1259 1271 N/A INTRINSIC
Pfam:MIB_HERC2 1277 1338 7.6e-27 PFAM
low complexity region 1373 1401 N/A INTRINSIC
low complexity region 1441 1458 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1600 1630 N/A INTRINSIC
low complexity region 1633 1651 N/A INTRINSIC
low complexity region 1674 1703 N/A INTRINSIC
low complexity region 1745 1752 N/A INTRINSIC
PDB:2LC3|A 1879 1966 4e-57 PDB
low complexity region 2101 2117 N/A INTRINSIC
HECTc 2143 2610 8.32e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179265
AA Change: E2189G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136449
Gene: ENSMUSG00000035247
AA Change: E2189G

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 396 425 1.44e-1 SMART
ANK 427 456 2.81e-4 SMART
ANK 460 489 1.55e2 SMART
low complexity region 491 510 N/A INTRINSIC
low complexity region 631 655 N/A INTRINSIC
low complexity region 708 724 N/A INTRINSIC
low complexity region 822 833 N/A INTRINSIC
Pfam:Sad1_UNC 1112 1245 1.3e-26 PFAM
low complexity region 1264 1276 N/A INTRINSIC
Pfam:MIB_HERC2 1282 1341 5.3e-26 PFAM
low complexity region 1378 1406 N/A INTRINSIC
low complexity region 1446 1463 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1513 1529 N/A INTRINSIC
low complexity region 1605 1635 N/A INTRINSIC
low complexity region 1638 1656 N/A INTRINSIC
low complexity region 1679 1708 N/A INTRINSIC
low complexity region 1750 1757 N/A INTRINSIC
PDB:2LC3|A 1884 1971 3e-57 PDB
low complexity region 2106 2122 N/A INTRINSIC
HECTc 2148 2618 4.5e-72 SMART
Meta Mutation Damage Score 0.8813 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Mice that are homozygous for either a gene trapped or an ENU-induced allele exhibit exencephaly associated with impaired head mesenchyme development and neural tube closure, and show eye and cranial vault dysplasia. Homozygotes for another ENU-induced allele show congenital cardiovascular defects. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Gene trapped(29) Chemically induced(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,620,354 M182R probably benign Het
Acsm4 C A 7: 119,703,374 H241N probably damaging Het
Arhgap32 G A 9: 32,256,799 A693T probably damaging Het
B4galnt3 G T 6: 120,214,798 A658D probably damaging Het
Car12 G A 9: 66,746,613 E84K probably benign Het
Crocc2 T A 1: 93,205,902 S969T probably damaging Het
Crym A G 7: 120,195,444 V184A possibly damaging Het
Cryzl2 T C 1: 157,465,013 C122R probably damaging Het
Defb30 T C 14: 63,036,014 E49G probably benign Het
Dnah3 A G 7: 119,951,580 L3161P probably damaging Het
Dnajc5g A G 5: 31,109,692 N104S probably benign Het
Fcgr1 T G 3: 96,286,986 K195T probably damaging Het
Gal C T 19: 3,411,167 R89H probably damaging Het
Gcfc2 C T 6: 81,948,335 A577V probably benign Het
Gm5116 A C 7: 32,495,954 noncoding transcript Het
Golga3 A T 5: 110,192,940 Q540L probably damaging Het
Hspa12a T C 19: 58,799,545 D615G probably damaging Het
Igkv14-130 A T 6: 67,791,481 Y107F probably damaging Het
Ldlr T A 9: 21,745,907 probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrrc37a A T 11: 103,498,240 S2120T unknown Het
Mtfmt G T 9: 65,439,615 V164F probably damaging Het
Nampt T C 12: 32,833,038 V74A probably damaging Het
Ndufc2 G T 7: 97,407,664 R120L probably damaging Het
Neo1 A T 9: 58,893,911 V1156D possibly damaging Het
Nlrp1b G A 11: 71,160,072 P1065S possibly damaging Het
Nop9 A G 14: 55,745,940 H56R possibly damaging Het
Olfr1287 A T 2: 111,449,589 T150S probably benign Het
Olfr790 A T 10: 129,501,309 M142L possibly damaging Het
Pign A T 1: 105,522,073 N909K possibly damaging Het
Prex1 A G 2: 166,572,963 V304A probably benign Het
Racgap1 G A 15: 99,628,762 R307W probably damaging Het
Rap1gds1 C A 3: 138,955,420 E399* probably null Het
Rwdd4a G A 8: 47,542,802 probably null Het
Scp2 T C 4: 108,071,291 T401A probably benign Het
Sdha A G 13: 74,327,333 F526S probably damaging Het
Shroom1 T A 11: 53,464,045 L264Q probably benign Het
Sorl1 T C 9: 41,996,294 T1466A probably benign Het
Trpm2 C T 10: 77,966,018 C71Y probably damaging Het
Ugt2b34 G A 5: 86,904,387 S250L probably benign Het
Vmn2r88 A G 14: 51,413,181 D117G probably benign Het
Wdr73 A T 7: 80,892,425 probably benign Het
Other mutations in Hectd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Hectd1 APN 12 51769108 missense possibly damaging 0.94
IGL00402:Hectd1 APN 12 51759432 missense probably benign
IGL00419:Hectd1 APN 12 51764035 missense probably damaging 0.99
IGL00518:Hectd1 APN 12 51776489 splice site probably benign
IGL00565:Hectd1 APN 12 51790398 missense probably damaging 0.97
IGL00574:Hectd1 APN 12 51774004 missense probably benign 0.17
IGL00576:Hectd1 APN 12 51759309 missense probably damaging 0.99
IGL00788:Hectd1 APN 12 51748788 missense probably damaging 0.99
IGL00978:Hectd1 APN 12 51791390 missense possibly damaging 0.95
IGL01328:Hectd1 APN 12 51761121 missense probably damaging 1.00
IGL01337:Hectd1 APN 12 51802274 missense possibly damaging 0.95
IGL01634:Hectd1 APN 12 51803779 missense probably damaging 0.98
IGL01731:Hectd1 APN 12 51802810 missense possibly damaging 0.59
IGL01920:Hectd1 APN 12 51782554 missense probably damaging 0.99
IGL01951:Hectd1 APN 12 51794497 nonsense probably null
IGL01994:Hectd1 APN 12 51797942 missense probably damaging 0.99
IGL02140:Hectd1 APN 12 51774137 missense probably damaging 0.99
IGL02150:Hectd1 APN 12 51769191 missense probably damaging 0.97
IGL02156:Hectd1 APN 12 51754133 splice site probably benign
IGL02177:Hectd1 APN 12 51772320 missense probably damaging 0.99
IGL02502:Hectd1 APN 12 51797852 missense possibly damaging 0.77
IGL02505:Hectd1 APN 12 51800713 critical splice donor site probably null
IGL02519:Hectd1 APN 12 51769111 missense probably damaging 0.99
IGL02624:Hectd1 APN 12 51762450 missense possibly damaging 0.61
IGL02833:Hectd1 APN 12 51764081 missense probably damaging 0.96
IGL02851:Hectd1 APN 12 51767640 missense possibly damaging 0.94
IGL02866:Hectd1 APN 12 51790613 missense probably damaging 1.00
IGL02981:Hectd1 APN 12 51768887 missense possibly damaging 0.70
IGL02987:Hectd1 APN 12 51744767 missense probably damaging 1.00
IGL02999:Hectd1 APN 12 51827422 missense possibly damaging 0.77
IGL03071:Hectd1 APN 12 51769174 missense probably benign 0.00
IGL03078:Hectd1 APN 12 51802236 missense probably damaging 0.98
IGL03299:Hectd1 APN 12 51800888 splice site probably benign
3-1:Hectd1 UTSW 12 51753807 missense probably damaging 0.99
R0039:Hectd1 UTSW 12 51753825 missense possibly damaging 0.83
R0238:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0238:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0268:Hectd1 UTSW 12 51769107 missense probably damaging 0.99
R0268:Hectd1 UTSW 12 51769108 missense possibly damaging 0.94
R0409:Hectd1 UTSW 12 51782556 missense possibly damaging 0.59
R1019:Hectd1 UTSW 12 51748657 missense probably damaging 0.99
R1072:Hectd1 UTSW 12 51761072 missense probably benign 0.11
R1087:Hectd1 UTSW 12 51776572 missense probably damaging 0.99
R1165:Hectd1 UTSW 12 51764164 splice site probably benign
R1350:Hectd1 UTSW 12 51762434 missense probably benign
R1553:Hectd1 UTSW 12 51773878 missense probably damaging 0.98
R1666:Hectd1 UTSW 12 51753824 missense possibly damaging 0.91
R1676:Hectd1 UTSW 12 51744788 missense probably damaging 1.00
R1694:Hectd1 UTSW 12 51744592 missense probably damaging 1.00
R1778:Hectd1 UTSW 12 51753807 missense probably damaging 0.99
R1856:Hectd1 UTSW 12 51744794 missense probably damaging 1.00
R1859:Hectd1 UTSW 12 51806567 missense probably damaging 1.00
R1884:Hectd1 UTSW 12 51800955 missense probably benign 0.00
R1982:Hectd1 UTSW 12 51785841 missense probably damaging 0.97
R2034:Hectd1 UTSW 12 51757116 splice site probably null
R2061:Hectd1 UTSW 12 51794444 missense probably damaging 0.99
R2078:Hectd1 UTSW 12 51748542 missense probably damaging 0.99
R2176:Hectd1 UTSW 12 51745494 missense probably damaging 1.00
R2210:Hectd1 UTSW 12 51806462 missense probably damaging 0.99
R2248:Hectd1 UTSW 12 51806471 missense probably damaging 0.99
R2282:Hectd1 UTSW 12 51769008 missense possibly damaging 0.95
R2402:Hectd1 UTSW 12 51745534 missense probably benign 0.01
R3876:Hectd1 UTSW 12 51768730 missense probably damaging 0.98
R4027:Hectd1 UTSW 12 51802436 critical splice acceptor site probably null
R4085:Hectd1 UTSW 12 51774750 missense possibly damaging 0.93
R4115:Hectd1 UTSW 12 51768723 nonsense probably null
R4116:Hectd1 UTSW 12 51768723 nonsense probably null
R4169:Hectd1 UTSW 12 51790225 missense probably damaging 0.97
R4434:Hectd1 UTSW 12 51752052 missense probably damaging 1.00
R4507:Hectd1 UTSW 12 51790493 missense probably damaging 0.97
R4578:Hectd1 UTSW 12 51751932 missense probably damaging 1.00
R4579:Hectd1 UTSW 12 51744573 missense probably damaging 0.97
R4709:Hectd1 UTSW 12 51787912 missense possibly damaging 0.94
R4812:Hectd1 UTSW 12 51827351 critical splice donor site probably null
R4883:Hectd1 UTSW 12 51784247 nonsense probably null
R4885:Hectd1 UTSW 12 51800722 missense probably damaging 0.97
R4975:Hectd1 UTSW 12 51762497 missense probably benign 0.02
R4983:Hectd1 UTSW 12 51784262 missense probably benign 0.01
R5007:Hectd1 UTSW 12 51802660 missense possibly damaging 0.95
R5062:Hectd1 UTSW 12 51744879 missense probably damaging 0.98
R5164:Hectd1 UTSW 12 51827489 start codon destroyed probably null 0.60
R5213:Hectd1 UTSW 12 51802533 critical splice donor site probably null
R5535:Hectd1 UTSW 12 51802326 missense probably damaging 0.98
R5776:Hectd1 UTSW 12 51764114 missense possibly damaging 0.91
R5846:Hectd1 UTSW 12 51773835 missense probably damaging 0.99
R5907:Hectd1 UTSW 12 51798754 missense probably damaging 0.98
R5911:Hectd1 UTSW 12 51802252 missense probably damaging 0.99
R5919:Hectd1 UTSW 12 51769072 missense probably damaging 0.98
R6051:Hectd1 UTSW 12 51754104 missense probably benign
R6141:Hectd1 UTSW 12 51746092 critical splice donor site probably null
R6172:Hectd1 UTSW 12 51769282 missense probably damaging 1.00
R6194:Hectd1 UTSW 12 51748445 missense probably damaging 0.99
R6356:Hectd1 UTSW 12 51744619 missense probably damaging 1.00
R6795:Hectd1 UTSW 12 51794487 missense possibly damaging 0.94
R6909:Hectd1 UTSW 12 51764162 splice site probably null
R6971:Hectd1 UTSW 12 51748743 nonsense probably null
R7079:Hectd1 UTSW 12 51787855 missense possibly damaging 0.96
R7104:Hectd1 UTSW 12 51827351 critical splice donor site probably null
R7171:Hectd1 UTSW 12 51759297 missense probably damaging 0.99
R7296:Hectd1 UTSW 12 51785852 missense possibly damaging 0.73
R7346:Hectd1 UTSW 12 51750321 missense probably benign
R7355:Hectd1 UTSW 12 51791298 missense possibly damaging 0.72
R7531:Hectd1 UTSW 12 51806367 missense probably benign 0.33
R7532:Hectd1 UTSW 12 51790450 missense probably damaging 0.98
R7755:Hectd1 UTSW 12 51802220 missense possibly damaging 0.86
R7807:Hectd1 UTSW 12 51745388 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGCCAGCAAGTATAGGC -3'
(R):5'- GGCCCAAGAATGTCAGATGAC -3'

Sequencing Primer
(F):5'- AGGCAAAAAACCTGGCTC -3'
(R):5'- CCAGCCTGGTCTAAAGAGAGTTC -3'
Posted On2016-06-15