Incidental Mutation 'R5046:Sdha'
ID394392
Institutional Source Beutler Lab
Gene Symbol Sdha
Ensembl Gene ENSMUSG00000021577
Gene Namesuccinate dehydrogenase complex, subunit A, flavoprotein (Fp)
SynonymsSDHF, FP, 2310034D06Rik, SDH2
MMRRC Submission 042636-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5046 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location74322254-74350280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74327333 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 526 (F526S)
Ref Sequence ENSEMBL: ENSMUSP00000022062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022062]
Predicted Effect probably damaging
Transcript: ENSMUST00000022062
AA Change: F526S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022062
Gene: ENSMUSG00000021577
AA Change: F526S

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:FAD_binding_2 63 457 1.2e-128 PFAM
Pfam:Succ_DH_flav_C 512 664 3.4e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161434
Predicted Effect probably benign
Transcript: ENSMUST00000221594
Meta Mutation Damage Score 0.9517 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major catalytic subunit of succinate-ubiquinone oxidoreductase, a complex of the mitochondrial respiratory chain. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. Mutations in this gene have been associated with a form of mitochondrial respiratory chain deficiency known as Leigh Syndrome. A pseudogene has been identified on chromosome 3q29. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,620,354 M182R probably benign Het
Acsm4 C A 7: 119,703,374 H241N probably damaging Het
Arhgap32 G A 9: 32,256,799 A693T probably damaging Het
B4galnt3 G T 6: 120,214,798 A658D probably damaging Het
Car12 G A 9: 66,746,613 E84K probably benign Het
Crocc2 T A 1: 93,205,902 S969T probably damaging Het
Crym A G 7: 120,195,444 V184A possibly damaging Het
Cryzl2 T C 1: 157,465,013 C122R probably damaging Het
Defb30 T C 14: 63,036,014 E49G probably benign Het
Dnah3 A G 7: 119,951,580 L3161P probably damaging Het
Dnajc5g A G 5: 31,109,692 N104S probably benign Het
Fcgr1 T G 3: 96,286,986 K195T probably damaging Het
Gal C T 19: 3,411,167 R89H probably damaging Het
Gcfc2 C T 6: 81,948,335 A577V probably benign Het
Gm5116 A C 7: 32,495,954 noncoding transcript Het
Golga3 A T 5: 110,192,940 Q540L probably damaging Het
Hectd1 T C 12: 51,750,388 E2184G probably damaging Het
Hspa12a T C 19: 58,799,545 D615G probably damaging Het
Igkv14-130 A T 6: 67,791,481 Y107F probably damaging Het
Ldlr T A 9: 21,745,907 probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrrc37a A T 11: 103,498,240 S2120T unknown Het
Mtfmt G T 9: 65,439,615 V164F probably damaging Het
Nampt T C 12: 32,833,038 V74A probably damaging Het
Ndufc2 G T 7: 97,407,664 R120L probably damaging Het
Neo1 A T 9: 58,893,911 V1156D possibly damaging Het
Nlrp1b G A 11: 71,160,072 P1065S possibly damaging Het
Nop9 A G 14: 55,745,940 H56R possibly damaging Het
Olfr1287 A T 2: 111,449,589 T150S probably benign Het
Olfr790 A T 10: 129,501,309 M142L possibly damaging Het
Pign A T 1: 105,522,073 N909K possibly damaging Het
Prex1 A G 2: 166,572,963 V304A probably benign Het
Racgap1 G A 15: 99,628,762 R307W probably damaging Het
Rap1gds1 C A 3: 138,955,420 E399* probably null Het
Rwdd4a G A 8: 47,542,802 probably null Het
Scp2 T C 4: 108,071,291 T401A probably benign Het
Shroom1 T A 11: 53,464,045 L264Q probably benign Het
Sorl1 T C 9: 41,996,294 T1466A probably benign Het
Trpm2 C T 10: 77,966,018 C71Y probably damaging Het
Ugt2b34 G A 5: 86,904,387 S250L probably benign Het
Vmn2r88 A G 14: 51,413,181 D117G probably benign Het
Wdr73 A T 7: 80,892,425 probably benign Het
Other mutations in Sdha
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0270:Sdha UTSW 13 74332247 missense probably damaging 1.00
R0480:Sdha UTSW 13 74327333 missense probably benign 0.36
R0960:Sdha UTSW 13 74323184 splice site probably benign
R1883:Sdha UTSW 13 74333136 missense probably damaging 0.98
R1884:Sdha UTSW 13 74333136 missense probably damaging 0.98
R2068:Sdha UTSW 13 74323968 splice site probably null
R3881:Sdha UTSW 13 74339192 missense probably damaging 1.00
R3894:Sdha UTSW 13 74334391 missense probably benign 0.03
R4063:Sdha UTSW 13 74323958 intron probably benign
R4384:Sdha UTSW 13 74326985 missense possibly damaging 0.89
R5432:Sdha UTSW 13 74326949 missense probably damaging 0.97
R5521:Sdha UTSW 13 74350099 intron probably benign
R5645:Sdha UTSW 13 74323839 critical splice donor site probably null
R5770:Sdha UTSW 13 74323120 nonsense probably null
R5797:Sdha UTSW 13 74334357 missense probably damaging 1.00
R5920:Sdha UTSW 13 74326925 critical splice donor site probably null
R6450:Sdha UTSW 13 74334293 splice site probably null
R7677:Sdha UTSW 13 74333053 nonsense probably null
R7793:Sdha UTSW 13 74331436 missense probably damaging 1.00
R8284:Sdha UTSW 13 74331297 critical splice donor site probably null
R8923:Sdha UTSW 13 74339060 missense probably damaging 1.00
Z1177:Sdha UTSW 13 74339632 missense probably damaging 1.00
Z1177:Sdha UTSW 13 74350193 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCAACATACAGCTGTGGGG -3'
(R):5'- CCAAGGTAAAATGGCATACTTGG -3'

Sequencing Primer
(F):5'- CTGGACAGCAGGCATGGAC -3'
(R):5'- TGGCATACTTGGAAGACTATAATAGG -3'
Posted On2016-06-15