Incidental Mutation 'R5046:Gal'
ID394398
Institutional Source Beutler Lab
Gene Symbol Gal
Ensembl Gene ENSMUSG00000024907
Gene Namegalanin
SynonymsGaln
MMRRC Submission 042636-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5046 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location3409919-3414472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3411167 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 89 (R89H)
Ref Sequence ENSEMBL: ENSMUSP00000025842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025840] [ENSMUST00000025842] [ENSMUST00000127142] [ENSMUST00000142193]
Predicted Effect probably benign
Transcript: ENSMUST00000025840
SMART Domains Protein: ENSMUSP00000025840
Gene: ENSMUSG00000024905

DomainStartEndE-ValueType
low complexity region 91 99 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
Blast:CXC 246 287 4e-13 BLAST
CXC 332 373 1.37e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000025842
AA Change: R89H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025842
Gene: ENSMUSG00000024907
AA Change: R89H

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
Galanin 20 124 3.41e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127142
SMART Domains Protein: ENSMUSP00000122687
Gene: ENSMUSG00000024905

DomainStartEndE-ValueType
Blast:CXC 67 107 1e-13 BLAST
CXC 152 193 1.37e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142193
SMART Domains Protein: ENSMUSP00000114171
Gene: ENSMUSG00000024905

DomainStartEndE-ValueType
Blast:CXC 67 107 1e-13 BLAST
CXC 152 193 1.37e-17 SMART
Meta Mutation Damage Score 0.4159 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: This gene encodes a neuroendocrine peptide that is principally produced by a subpopulation of lactotrophs in the pituitary gland. The encoded protein is a precursor that is proteolytically processed to generate two mature peptides: galanin and galanin message-associated peptide (GMAP). Mice lacking the encoded protein fail to lactate sufficiently due to abnormalities in the expression of prolactin and lactotroph proliferation, exhibit attenuated chronic neuropathic pain and developmental deficits in the dorsal root ganglion neurons. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature proteins. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to alterations in neuroendocrine homeostasis, prolactin release, lactotroph number, mammary gland maturation, lactation, susceptibility to neuronal excitotoxicity and induced seizures, sensory neuron developmentand regeneration, and long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,620,354 M182R probably benign Het
Acsm4 C A 7: 119,703,374 H241N probably damaging Het
Arhgap32 G A 9: 32,256,799 A693T probably damaging Het
B4galnt3 G T 6: 120,214,798 A658D probably damaging Het
Car12 G A 9: 66,746,613 E84K probably benign Het
Crocc2 T A 1: 93,205,902 S969T probably damaging Het
Crym A G 7: 120,195,444 V184A possibly damaging Het
Cryzl2 T C 1: 157,465,013 C122R probably damaging Het
Defb30 T C 14: 63,036,014 E49G probably benign Het
Dnah3 A G 7: 119,951,580 L3161P probably damaging Het
Dnajc5g A G 5: 31,109,692 N104S probably benign Het
Fcgr1 T G 3: 96,286,986 K195T probably damaging Het
Gcfc2 C T 6: 81,948,335 A577V probably benign Het
Gm5116 A C 7: 32,495,954 noncoding transcript Het
Golga3 A T 5: 110,192,940 Q540L probably damaging Het
Hectd1 T C 12: 51,750,388 E2184G probably damaging Het
Hspa12a T C 19: 58,799,545 D615G probably damaging Het
Igkv14-130 A T 6: 67,791,481 Y107F probably damaging Het
Ldlr T A 9: 21,745,907 probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrrc37a A T 11: 103,498,240 S2120T unknown Het
Mtfmt G T 9: 65,439,615 V164F probably damaging Het
Nampt T C 12: 32,833,038 V74A probably damaging Het
Ndufc2 G T 7: 97,407,664 R120L probably damaging Het
Neo1 A T 9: 58,893,911 V1156D possibly damaging Het
Nlrp1b G A 11: 71,160,072 P1065S possibly damaging Het
Nop9 A G 14: 55,745,940 H56R possibly damaging Het
Olfr1287 A T 2: 111,449,589 T150S probably benign Het
Olfr790 A T 10: 129,501,309 M142L possibly damaging Het
Pign A T 1: 105,522,073 N909K possibly damaging Het
Prex1 A G 2: 166,572,963 V304A probably benign Het
Racgap1 G A 15: 99,628,762 R307W probably damaging Het
Rap1gds1 C A 3: 138,955,420 E399* probably null Het
Rwdd4a G A 8: 47,542,802 probably null Het
Scp2 T C 4: 108,071,291 T401A probably benign Het
Sdha A G 13: 74,327,333 F526S probably damaging Het
Shroom1 T A 11: 53,464,045 L264Q probably benign Het
Sorl1 T C 9: 41,996,294 T1466A probably benign Het
Trpm2 C T 10: 77,966,018 C71Y probably damaging Het
Ugt2b34 G A 5: 86,904,387 S250L probably benign Het
Vmn2r88 A G 14: 51,413,181 D117G probably benign Het
Wdr73 A T 7: 80,892,425 probably benign Het
Other mutations in Gal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Gal APN 19 3411575 missense probably benign 0.02
R0385:Gal UTSW 19 3411171 missense probably benign 0.13
R3605:Gal UTSW 19 3414026 splice site probably null
R4817:Gal UTSW 19 3411126 splice site probably null
R4911:Gal UTSW 19 3411590 missense probably benign 0.15
R5921:Gal UTSW 19 3410100 missense probably damaging 0.99
R6660:Gal UTSW 19 3410108 missense possibly damaging 0.52
R7658:Gal UTSW 19 3413309 missense probably damaging 1.00
X0065:Gal UTSW 19 3411181 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCGAGTGTGACTAGCCTCAGTC -3'
(R):5'- GGCATGCACCTACAACAAGG -3'

Sequencing Primer
(F):5'- GAGTGTGACTAGCCTCAGTCCTAAC -3'
(R):5'- ACCTACAACAAGGGGCCTGG -3'
Posted On2016-06-15