Incidental Mutation 'R5047:Tatdn3'
ID394400
Institutional Source Beutler Lab
Gene Symbol Tatdn3
Ensembl Gene ENSMUSG00000026632
Gene NameTatD DNase domain containing 3
Synonyms
MMRRC Submission 042637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5047 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location191045826-191062932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 191046278 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 239 (I239F)
Ref Sequence ENSEMBL: ENSMUSP00000106518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027945] [ENSMUST00000077889] [ENSMUST00000085633] [ENSMUST00000110891] [ENSMUST00000110893] [ENSMUST00000192151]
Predicted Effect probably damaging
Transcript: ENSMUST00000027945
AA Change: I238F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027945
Gene: ENSMUSG00000026632
AA Change: I238F

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 263 5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077889
Predicted Effect probably benign
Transcript: ENSMUST00000085633
SMART Domains Protein: ENSMUSP00000082773
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 170 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110891
SMART Domains Protein: ENSMUSP00000106516
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 231 2.3e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110893
AA Change: I239F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106518
Gene: ENSMUSG00000026632
AA Change: I239F

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 264 1.8e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156341
Predicted Effect probably benign
Transcript: ENSMUST00000192151
Meta Mutation Damage Score 0.8422 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,770,438 A526D probably damaging Het
4930503E14Rik A T 14: 44,169,241 M117K possibly damaging Het
Adamts13 G A 2: 26,996,910 A1020T probably damaging Het
Atg3 C A 16: 45,178,232 D132E probably benign Het
Blzf1 A G 1: 164,306,468 M4T possibly damaging Het
Cdon G A 9: 35,478,639 R863Q probably damaging Het
Cyp2d40 C T 15: 82,760,259 R255H unknown Het
Evi5 T C 5: 107,821,874 K57R probably damaging Het
Fam186b T C 15: 99,280,686 E253G probably damaging Het
Fcgr1 A T 3: 96,285,884 F266I probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm10142 G T 10: 77,716,162 C119F probably damaging Het
Gpr63 A G 4: 25,008,202 S309G probably benign Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Jmy T A 13: 93,441,572 H696L possibly damaging Het
Kif13a T C 13: 46,788,085 H972R probably benign Het
Lama1 C T 17: 67,743,281 Q296* probably null Het
Lmf1 C T 17: 25,631,838 probably benign Het
Lpp T C 16: 24,971,846 C352R probably damaging Het
Ltbp1 T C 17: 75,292,886 probably benign Het
Maml3 G T 3: 51,690,841 D807E possibly damaging Het
Mdc1 T A 17: 35,847,844 V372D probably benign Het
Mst1 C A 9: 108,084,309 H579Q probably benign Het
Olfr1238 A G 2: 89,406,713 V122A probably damaging Het
Olfr26 G A 9: 38,855,289 V76I probably benign Het
Olfr398 T C 11: 73,984,378 T77A probably damaging Het
Olfr739 T C 14: 50,425,239 F240S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Phlpp2 A T 8: 109,913,619 H472L probably benign Het
Plscr3 A G 11: 69,850,091 probably null Het
Rab7 A T 6: 88,005,223 probably null Het
Rad50 A G 11: 53,674,696 probably null Het
Scgb1b20 A G 7: 33,373,312 probably null Het
Scn9a A C 2: 66,562,480 L256R probably damaging Het
Spag1 G T 15: 36,195,442 Q260H probably damaging Het
Tcof1 A G 18: 60,831,914 S578P possibly damaging Het
Top3b A G 16: 16,891,418 T657A probably benign Het
Tstd3 A G 4: 21,759,621 probably null Het
Ttc4 A T 4: 106,668,238 L233H probably damaging Het
Vmn2r-ps130 T A 17: 23,063,820 M158K probably benign Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp976 A T 7: 42,613,419 C331* probably null Het
Other mutations in Tatdn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Tatdn3 APN 1 191055381 splice site probably benign
IGL02819:Tatdn3 APN 1 191055344 missense probably benign 0.04
IGL02898:Tatdn3 APN 1 191046310 makesense probably null
R0718:Tatdn3 UTSW 1 191052849 splice site probably benign
R0892:Tatdn3 UTSW 1 191062805 missense probably benign 0.22
R1635:Tatdn3 UTSW 1 191060176 missense probably benign
R2018:Tatdn3 UTSW 1 191049280 critical splice donor site probably null
R2088:Tatdn3 UTSW 1 191052876 missense possibly damaging 0.59
R2243:Tatdn3 UTSW 1 191052900 missense probably damaging 1.00
R3933:Tatdn3 UTSW 1 191046324 splice site probably null
R4676:Tatdn3 UTSW 1 191049334 missense probably damaging 1.00
R5923:Tatdn3 UTSW 1 191049310 missense probably damaging 1.00
R6044:Tatdn3 UTSW 1 191056361 critical splice donor site probably null
R6066:Tatdn3 UTSW 1 191046268 missense probably benign 0.24
R7770:Tatdn3 UTSW 1 191058856 missense probably benign 0.05
R8331:Tatdn3 UTSW 1 191046211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCTGAGGCCACTAAAGC -3'
(R):5'- TGCCAAGTTCATCCACCCTG -3'

Sequencing Primer
(F):5'- GGCCACTAAAGCAAGCCCTTG -3'
(R):5'- AAAGGAATGTCAGCTCCTTCATAGAG -3'
Posted On2016-06-15