Mutagenetix > Incidental Mutation

Incidental Mutation 'R5047:Scn9a'

394402

Institutional Source

Beutler Lab

Gene Symbol

Scn9a

Ensembl Gene

ENSMUSG00000075316

Gene Name

sodium channel, voltage-gated, type IX, alpha

Synonyms

PN1

MMRRC Submission

042637-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5047 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

66480080-66634962 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 66562480 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 256 (L256R)

Ref Sequence

ENSEMBL: ENSMUSP00000131711 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]

AlphaFold

Q62205

Predicted Effect

probably damaging
Transcript: ENSMUST00000100063
AA Change: L256R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: L256R

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	403	9.5e-78	PFAM
coiled coil region	404	442	N/A	INTRINSIC
Pfam:DUF3451	465	685	1.3e-62	PFAM
Pfam:Ion_trans	768	957	9.9e-48	PFAM
Pfam:Na_trans_assoc	972	1191	2.9e-72	PFAM
low complexity region	1203	1214	N/A	INTRINSIC
Pfam:Ion_trans	1217	1445	2.8e-55	PFAM
PDB:1BYY\|A	1447	1499	9e-27	PDB
Pfam:Ion_trans	1538	1748	3.4e-52	PFAM
Pfam:PKD_channel	1599	1755	1.1e-7	PFAM
IQ	1877	1899	1.03e-3	SMART
low complexity region	1956	1972	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100064
AA Change: L256R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: L256R

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	125	412	2.2e-84	PFAM
low complexity region	433	446	N/A	INTRINSIC
Pfam:Na_trans_cytopl	483	693	7.5e-76	PFAM
Pfam:Ion_trans	742	977	4.1e-57	PFAM
Pfam:Na_trans_assoc	981	1185	1.4e-58	PFAM
Pfam:Ion_trans	1189	1466	7e-67	PFAM
Pfam:Ion_trans	1512	1769	1e-55	PFAM
Pfam:PKD_channel	1605	1763	2.6e-7	PFAM
IQ	1886	1908	1.03e-3	SMART
low complexity region	1965	1981	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112354
AA Change: L256R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: L256R

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	1.2e-77	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	683	1.3e-62	PFAM
Pfam:Ion_trans	766	955	9.9e-48	PFAM
Pfam:Na_trans_assoc	970	1189	2.9e-72	PFAM
low complexity region	1201	1212	N/A	INTRINSIC
Pfam:Ion_trans	1215	1443	2.8e-55	PFAM
PDB:1BYY\|A	1445	1497	7e-29	PDB
Pfam:Ion_trans	1536	1746	3.4e-52	PFAM
Pfam:PKD_channel	1597	1753	1.1e-7	PFAM
IQ	1875	1897	1.03e-3	SMART
low complexity region	1954	1970	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141603

Predicted Effect

probably damaging
Transcript: ENSMUST00000164384
AA Change: L256R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: L256R

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	1.1e-77	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	694	4.2e-66	PFAM
Pfam:Ion_trans	777	966	8.8e-48	PFAM
Pfam:Na_trans_assoc	981	1200	6e-72	PFAM
low complexity region	1212	1223	N/A	INTRINSIC
Pfam:Ion_trans	1226	1454	2.5e-55	PFAM
PDB:1BYY\|A	1456	1508	6e-29	PDB
Pfam:Ion_trans	1547	1757	3e-52	PFAM
Pfam:PKD_channel	1608	1764	8.1e-8	PFAM
IQ	1886	1908	1.03e-3	SMART
low complexity region	1965	1981	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169900
AA Change: L256R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: L256R

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	3.7e-78	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	683	1.3e-62	PFAM
Pfam:Ion_trans	766	955	9.9e-48	PFAM
Pfam:Na_trans_assoc	970	1189	2.9e-72	PFAM
low complexity region	1201	1212	N/A	INTRINSIC
Pfam:Ion_trans	1215	1443	2.8e-55	PFAM
PDB:1BYY\|A	1445	1497	7e-29	PDB
Pfam:Ion_trans	1536	1746	3.4e-52	PFAM
Pfam:PKD_channel	1597	1753	1.1e-7	PFAM
IQ	1875	1897	1.03e-3	SMART
low complexity region	1954	1970	N/A	INTRINSIC

Meta Mutation Damage Score

0.7721

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.5%

Validation Efficiency

96% (49/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	G	T	14: 49,770,438	A526D	probably damaging	Het
4930503E14Rik	A	T	14: 44,169,241	M117K	possibly damaging	Het
Adamts13	G	A	2: 26,996,910	A1020T	probably damaging	Het
Atg3	C	A	16: 45,178,232	D132E	probably benign	Het
Blzf1	A	G	1: 164,306,468	M4T	possibly damaging	Het
Cdon	G	A	9: 35,478,639	R863Q	probably damaging	Het
Cyp2d40	C	T	15: 82,760,259	R255H	unknown	Het
Evi5	T	C	5: 107,821,874	K57R	probably damaging	Het
Fam186b	T	C	15: 99,280,686	E253G	probably damaging	Het
Fcgr1	A	T	3: 96,285,884	F266I	probably benign	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Gm10142	G	T	10: 77,716,162	C119F	probably damaging	Het
Gpr63	A	G	4: 25,008,202	S309G	probably benign	Het
Herc3	C	T	6: 58,855,760	Q137*	probably null	Het
Jmy	T	A	13: 93,441,572	H696L	possibly damaging	Het
Kif13a	T	C	13: 46,788,085	H972R	probably benign	Het
Lama1	C	T	17: 67,743,281	Q296*	probably null	Het
Lmf1	C	T	17: 25,631,838		probably benign	Het
Lpp	T	C	16: 24,971,846	C352R	probably damaging	Het
Ltbp1	T	C	17: 75,292,886		probably benign	Het
Maml3	G	T	3: 51,690,841	D807E	possibly damaging	Het
Mdc1	T	A	17: 35,847,844	V372D	probably benign	Het
Mst1	C	A	9: 108,084,309	H579Q	probably benign	Het
Olfr1238	A	G	2: 89,406,713	V122A	probably damaging	Het
Olfr26	G	A	9: 38,855,289	V76I	probably benign	Het
Olfr398	T	C	11: 73,984,378	T77A	probably damaging	Het
Olfr739	T	C	14: 50,425,239	F240S	probably damaging	Het
Pcdhb22	G	T	18: 37,519,126	G216C	probably damaging	Het
Phlpp2	A	T	8: 109,913,619	H472L	probably benign	Het
Plscr3	A	G	11: 69,850,091		probably null	Het
Rab7	A	T	6: 88,005,223		probably null	Het
Rad50	A	G	11: 53,674,696		probably null	Het
Scgb1b20	A	G	7: 33,373,312		probably null	Het
Spag1	G	T	15: 36,195,442	Q260H	probably damaging	Het
Tatdn3	T	A	1: 191,046,278	I239F	probably damaging	Het
Tcof1	A	G	18: 60,831,914	S578P	possibly damaging	Het
Top3b	A	G	16: 16,891,418	T657A	probably benign	Het
Tstd3	A	G	4: 21,759,621		probably null	Het
Ttc4	A	T	4: 106,668,238	L233H	probably damaging	Het
Vmn2r-ps130	T	A	17: 23,063,820	M158K	probably benign	Het
Yeats2	A	T	16: 20,208,465	Q822L	probably damaging	Het
Zfp976	A	T	7: 42,613,419	C331*	probably null	Het

Other mutations in Scn9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Scn9a	APN	2	66563601	missense	probably damaging	1.00
IGL00570:Scn9a	APN	2	66484142	missense	probably damaging	1.00
IGL00809:Scn9a	APN	2	66483935	missense	probably damaging	1.00
IGL00977:Scn9a	APN	2	66484301	missense	probably damaging	0.99
IGL01120:Scn9a	APN	2	66526972	missense	probably benign	0.00
IGL01134:Scn9a	APN	2	66504968	missense	probably damaging	1.00
IGL01300:Scn9a	APN	2	66488053	nonsense	probably null
IGL01452:Scn9a	APN	2	66527072	missense	probably damaging	1.00
IGL01531:Scn9a	APN	2	66537378	missense	probably benign	0.11
IGL01572:Scn9a	APN	2	66493886	missense	probably benign	0.00
IGL01645:Scn9a	APN	2	66487642	missense	possibly damaging	0.62
IGL01823:Scn9a	APN	2	66484042	missense	probably damaging	1.00
IGL01965:Scn9a	APN	2	66484433	missense	probably damaging	1.00
IGL02127:Scn9a	APN	2	66547135	missense	probably damaging	1.00
IGL02127:Scn9a	APN	2	66494826	missense	probably damaging	1.00
IGL02166:Scn9a	APN	2	66493103	missense	possibly damaging	0.95
IGL02183:Scn9a	APN	2	66484611	splice site	probably benign
IGL02640:Scn9a	APN	2	66536096	critical splice donor site	probably null
IGL02685:Scn9a	APN	2	66537293	missense	probably damaging	1.00
IGL02798:Scn9a	APN	2	66540559	missense	possibly damaging	0.52
IGL02832:Scn9a	APN	2	66568029	missense	probably damaging	1.00
IGL03008:Scn9a	APN	2	66562511	missense	probably damaging	1.00
IGL03270:Scn9a	APN	2	66484014	missense	probably damaging	1.00
IGL03408:Scn9a	APN	2	66526747	missense	probably benign	0.00
BB007:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
BB017:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
R0039:Scn9a	UTSW	2	66562444	missense	probably damaging	0.98
R0173:Scn9a	UTSW	2	66533093	missense	probably damaging	1.00
R0323:Scn9a	UTSW	2	66568131	missense	probably damaging	1.00
R0344:Scn9a	UTSW	2	66505010	missense	probably damaging	0.99
R0421:Scn9a	UTSW	2	66543277	missense	probably benign
R0465:Scn9a	UTSW	2	66526996	missense	probably damaging	1.00
R0514:Scn9a	UTSW	2	66483678	missense	probably damaging	1.00
R0599:Scn9a	UTSW	2	66526799	missense	probably damaging	0.96
R0627:Scn9a	UTSW	2	66537377	missense	probably benign	0.00
R0644:Scn9a	UTSW	2	66533061	critical splice donor site	probably null
R0653:Scn9a	UTSW	2	66533377	missense	probably damaging	1.00
R0685:Scn9a	UTSW	2	66483499	missense	probably benign	0.02
R0718:Scn9a	UTSW	2	66547112	missense	probably damaging	1.00
R0827:Scn9a	UTSW	2	66536124	nonsense	probably null
R0890:Scn9a	UTSW	2	66483735	missense	probably damaging	1.00
R1139:Scn9a	UTSW	2	66504997	missense	probably benign	0.02
R1385:Scn9a	UTSW	2	66563542	missense	probably damaging	1.00
R1398:Scn9a	UTSW	2	66484586	missense	probably benign	0.11
R1496:Scn9a	UTSW	2	66526888	missense	probably benign
R1511:Scn9a	UTSW	2	66526813	missense	probably benign	0.01
R1517:Scn9a	UTSW	2	66505027	splice site	probably benign
R1564:Scn9a	UTSW	2	66484304	missense	probably damaging	1.00
R1634:Scn9a	UTSW	2	66488017	missense	probably damaging	1.00
R1662:Scn9a	UTSW	2	66483459	missense	probably benign	0.00
R1695:Scn9a	UTSW	2	66504876	nonsense	probably null
R1709:Scn9a	UTSW	2	66483506	missense	probably damaging	1.00
R1741:Scn9a	UTSW	2	66487594	missense	probably damaging	0.99
R1755:Scn9a	UTSW	2	66501716	missense	probably benign	0.38
R1914:Scn9a	UTSW	2	66566250	missense	probably damaging	1.00
R1962:Scn9a	UTSW	2	66484311	missense	probably damaging	1.00
R1970:Scn9a	UTSW	2	66515380	missense	probably damaging	0.97
R2017:Scn9a	UTSW	2	66515321	missense	probably damaging	0.99
R2092:Scn9a	UTSW	2	66533376	missense	probably damaging	0.99
R2105:Scn9a	UTSW	2	66568183	missense	probably benign	0.25
R2114:Scn9a	UTSW	2	66484052	missense	probably damaging	1.00
R2115:Scn9a	UTSW	2	66484052	missense	probably damaging	1.00
R2128:Scn9a	UTSW	2	66526654	missense	probably damaging	1.00
R2157:Scn9a	UTSW	2	66536325	missense	probably damaging	1.00
R2162:Scn9a	UTSW	2	66534229	missense	probably damaging	0.98
R2350:Scn9a	UTSW	2	66504968	missense	probably damaging	1.00
R3694:Scn9a	UTSW	2	66562405	missense	probably benign
R3771:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3772:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3773:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3922:Scn9a	UTSW	2	66526873	missense	possibly damaging	0.88
R3926:Scn9a	UTSW	2	66526873	missense	possibly damaging	0.88
R4258:Scn9a	UTSW	2	66565054	intron	probably benign
R4385:Scn9a	UTSW	2	66484556	missense	probably damaging	1.00
R4415:Scn9a	UTSW	2	66526693	missense	probably damaging	1.00
R4570:Scn9a	UTSW	2	66483558	missense	possibly damaging	0.85
R4682:Scn9a	UTSW	2	66547018	missense	probably benign
R4783:Scn9a	UTSW	2	66540623	missense	probably benign	0.01
R4822:Scn9a	UTSW	2	66483749	missense	possibly damaging	0.55
R4829:Scn9a	UTSW	2	66551713	missense	probably benign
R4908:Scn9a	UTSW	2	66526743	missense	probably benign	0.03
R4983:Scn9a	UTSW	2	66566270	missense	probably benign	0.02
R5100:Scn9a	UTSW	2	66534119	missense	probably damaging	1.00
R5140:Scn9a	UTSW	2	66565167	missense	possibly damaging	0.81
R5398:Scn9a	UTSW	2	66488043	missense	probably damaging	1.00
R5557:Scn9a	UTSW	2	66547103	missense	probably damaging	0.99
R5582:Scn9a	UTSW	2	66565029	intron	probably benign
R6108:Scn9a	UTSW	2	66484049	missense	probably damaging	1.00
R6115:Scn9a	UTSW	2	66563629	missense	possibly damaging	0.70
R6143:Scn9a	UTSW	2	66487524	missense	probably benign	0.00
R6261:Scn9a	UTSW	2	66483896	missense	probably damaging	1.00
R6335:Scn9a	UTSW	2	66568264	start codon destroyed	possibly damaging	0.91
R6429:Scn9a	UTSW	2	66526963	missense	possibly damaging	0.95
R6632:Scn9a	UTSW	2	66483502	missense	probably benign	0.23
R6681:Scn9a	UTSW	2	66563342	missense	possibly damaging	0.90
R6830:Scn9a	UTSW	2	66568029	missense	probably damaging	1.00
R7102:Scn9a	UTSW	2	66549015	missense	probably damaging	1.00
R7186:Scn9a	UTSW	2	66534223	missense	probably damaging	1.00
R7243:Scn9a	UTSW	2	66540530	missense	probably damaging	1.00
R7311:Scn9a	UTSW	2	66484404	missense	possibly damaging	0.54
R7328:Scn9a	UTSW	2	66484587	missense	probably benign
R7386:Scn9a	UTSW	2	66540550	missense	probably damaging	1.00
R7438:Scn9a	UTSW	2	66547187	missense	possibly damaging	0.81
R7483:Scn9a	UTSW	2	66533348	missense	probably damaging	0.99
R7485:Scn9a	UTSW	2	66534217	missense	probably damaging	1.00
R7526:Scn9a	UTSW	2	66483646	missense	probably benign
R7617:Scn9a	UTSW	2	66540549	missense	possibly damaging	0.55
R7642:Scn9a	UTSW	2	66536236	missense	probably benign	0.02
R7653:Scn9a	UTSW	2	66527080	missense	probably damaging	1.00
R7747:Scn9a	UTSW	2	66484298	missense	probably damaging	1.00
R7823:Scn9a	UTSW	2	66483791	missense	probably damaging	1.00
R7864:Scn9a	UTSW	2	66484560	missense	possibly damaging	0.73
R7890:Scn9a	UTSW	2	66543112	missense	probably benign	0.00
R7930:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
R7975:Scn9a	UTSW	2	66484253	missense	probably damaging	1.00
R8057:Scn9a	UTSW	2	66515430	missense	probably benign	0.06
R8145:Scn9a	UTSW	2	66487410	missense	probably damaging	1.00
R8163:Scn9a	UTSW	2	66484401	missense	probably damaging	1.00
R8165:Scn9a	UTSW	2	66540530	missense	probably damaging	1.00
R8342:Scn9a	UTSW	2	66536282	missense	probably benign
R8345:Scn9a	UTSW	2	66494622	missense	probably damaging	0.96
R8464:Scn9a	UTSW	2	66566281	missense	probably damaging	0.99
R8467:Scn9a	UTSW	2	66501671	missense	probably damaging	1.00
R8698:Scn9a	UTSW	2	66536284	missense	probably benign	0.00
R8810:Scn9a	UTSW	2	66501666	missense	probably damaging	1.00
R8822:Scn9a	UTSW	2	66540635	missense	probably damaging	0.99
R8829:Scn9a	UTSW	2	66483617	missense	probably benign
R9009:Scn9a	UTSW	2	66508583	missense	probably damaging	1.00
R9038:Scn9a	UTSW	2	66494803	missense	probably damaging	1.00
R9126:Scn9a	UTSW	2	66484400	missense	probably damaging	1.00
R9205:Scn9a	UTSW	2	66533313	missense	probably damaging	1.00
R9300:Scn9a	UTSW	2	66504892	missense	probably benign	0.39
R9373:Scn9a	UTSW	2	66483917	missense	probably benign	0.00
R9404:Scn9a	UTSW	2	66526696	missense	probably benign	0.02
R9443:Scn9a	UTSW	2	66565209	missense	probably damaging	1.00
R9590:Scn9a	UTSW	2	66483984	missense	probably benign	0.05
R9612:Scn9a	UTSW	2	66533364	missense	probably damaging	1.00
R9617:Scn9a	UTSW	2	66562465	missense	probably damaging	1.00
R9717:Scn9a	UTSW	2	66526658	missense	probably benign
X0003:Scn9a	UTSW	2	66508647	missense	probably benign	0.02
X0062:Scn9a	UTSW	2	66568077	missense	probably damaging	1.00
Z1176:Scn9a	UTSW	2	66540592	missense	probably benign	0.00
Z1177:Scn9a	UTSW	2	66494685	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- ATCACACACTGACAAGTTTCTGTTG -3'
(R):5'- GCACTCCTAGTTAGGCTTGTG -3'

Sequencing Primer
(F):5'- GAAGAGAGTCACACTTATGTTCTTTC -3'
(R):5'- ACTCCTAGTTAGGCTTGTGTTTTGAC -3'

Posted On

2016-06-15