Incidental Mutation 'R5047:Fcgr1'
ID394405
Institutional Source Beutler Lab
Gene Symbol Fcgr1
Ensembl Gene ENSMUSG00000015947
Gene NameFc receptor, IgG, high affinity I
SynonymsCD64, FcgammaRI
MMRRC Submission 042637-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R5047 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location96282909-96293969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96285884 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 266 (F266I)
Ref Sequence ENSEMBL: ENSMUSP00000029748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029748]
Predicted Effect probably benign
Transcript: ENSMUST00000029748
AA Change: F266I

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029748
Gene: ENSMUSG00000015947
AA Change: F266I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 38 111 1.8e-5 SMART
IGc2 125 184 6.11e-8 SMART
IG 206 290 7.3e-6 SMART
transmembrane domain 298 320 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200420
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays an important role in the immune response. This protein is a high-affinity Fc-gamma receptor. The gene is one of three related gene family members located on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results immune response defects including a decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,770,438 A526D probably damaging Het
4930503E14Rik A T 14: 44,169,241 M117K possibly damaging Het
Adamts13 G A 2: 26,996,910 A1020T probably damaging Het
Atg3 C A 16: 45,178,232 D132E probably benign Het
Blzf1 A G 1: 164,306,468 M4T possibly damaging Het
Cdon G A 9: 35,478,639 R863Q probably damaging Het
Cyp2d40 C T 15: 82,760,259 R255H unknown Het
Evi5 T C 5: 107,821,874 K57R probably damaging Het
Fam186b T C 15: 99,280,686 E253G probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm10142 G T 10: 77,716,162 C119F probably damaging Het
Gpr63 A G 4: 25,008,202 S309G probably benign Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Jmy T A 13: 93,441,572 H696L possibly damaging Het
Kif13a T C 13: 46,788,085 H972R probably benign Het
Lama1 C T 17: 67,743,281 Q296* probably null Het
Lmf1 C T 17: 25,631,838 probably benign Het
Lpp T C 16: 24,971,846 C352R probably damaging Het
Ltbp1 T C 17: 75,292,886 probably benign Het
Maml3 G T 3: 51,690,841 D807E possibly damaging Het
Mdc1 T A 17: 35,847,844 V372D probably benign Het
Mst1 C A 9: 108,084,309 H579Q probably benign Het
Olfr1238 A G 2: 89,406,713 V122A probably damaging Het
Olfr26 G A 9: 38,855,289 V76I probably benign Het
Olfr398 T C 11: 73,984,378 T77A probably damaging Het
Olfr739 T C 14: 50,425,239 F240S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Phlpp2 A T 8: 109,913,619 H472L probably benign Het
Plscr3 A G 11: 69,850,091 probably null Het
Rab7 A T 6: 88,005,223 probably null Het
Rad50 A G 11: 53,674,696 probably null Het
Scgb1b20 A G 7: 33,373,312 probably null Het
Scn9a A C 2: 66,562,480 L256R probably damaging Het
Spag1 G T 15: 36,195,442 Q260H probably damaging Het
Tatdn3 T A 1: 191,046,278 I239F probably damaging Het
Tcof1 A G 18: 60,831,914 S578P possibly damaging Het
Top3b A G 16: 16,891,418 T657A probably benign Het
Tstd3 A G 4: 21,759,621 probably null Het
Ttc4 A T 4: 106,668,238 L233H probably damaging Het
Vmn2r-ps130 T A 17: 23,063,820 M158K probably benign Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp976 A T 7: 42,613,419 C331* probably null Het
Other mutations in Fcgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Fcgr1 APN 3 96284370 missense probably benign 0.01
IGL02142:Fcgr1 APN 3 96284577 missense probably benign 0.41
IGL03086:Fcgr1 APN 3 96284498 nonsense probably null
F5770:Fcgr1 UTSW 3 96284276 makesense probably null
FR4737:Fcgr1 UTSW 3 96284504 frame shift probably null
FR4737:Fcgr1 UTSW 3 96287094 missense probably benign 0.01
R0323:Fcgr1 UTSW 3 96285829 missense possibly damaging 0.84
R0594:Fcgr1 UTSW 3 96292312 missense probably damaging 1.00
R0926:Fcgr1 UTSW 3 96292366 missense possibly damaging 0.79
R1951:Fcgr1 UTSW 3 96287070 missense probably damaging 1.00
R1953:Fcgr1 UTSW 3 96287070 missense probably damaging 1.00
R1993:Fcgr1 UTSW 3 96285868 missense probably damaging 0.98
R2255:Fcgr1 UTSW 3 96285917 missense possibly damaging 0.88
R3941:Fcgr1 UTSW 3 96286033 missense probably benign 0.13
R4004:Fcgr1 UTSW 3 96284352 missense probably benign 0.00
R4409:Fcgr1 UTSW 3 96284577 missense probably benign 0.41
R5046:Fcgr1 UTSW 3 96286986 missense probably damaging 0.99
R6970:Fcgr1 UTSW 3 96284620 critical splice acceptor site probably null
R7339:Fcgr1 UTSW 3 96284299 missense not run
R7939:Fcgr1 UTSW 3 96284627 splice site probably null
V7581:Fcgr1 UTSW 3 96284276 makesense probably null
V7582:Fcgr1 UTSW 3 96284276 makesense probably null
V7583:Fcgr1 UTSW 3 96284276 makesense probably null
X0028:Fcgr1 UTSW 3 96286027 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GGTGACTGCAGTTCTGAAGG -3'
(R):5'- GAATACCCTGTCCCTTGTCAAC -3'

Sequencing Primer
(F):5'- AAGGAGGCGTAGAGTGTTCCTC -3'
(R):5'- TAGAGCTGTTTACCACGCCAG -3'
Posted On2016-06-15