Incidental Mutation 'R5047:Ttc4'
ID394408
Institutional Source Beutler Lab
Gene Symbol Ttc4
Ensembl Gene ENSMUSG00000025413
Gene Nametetratricopeptide repeat domain 4
Synonyms2810002P21Rik, L62
MMRRC Submission 042637-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R5047 (G1)
Quality Score200
Status Validated
Chromosome4
Chromosomal Location106662256-106678944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106668238 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 233 (L233H)
Ref Sequence ENSEMBL: ENSMUSP00000026480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026480] [ENSMUST00000106772] [ENSMUST00000135676]
Predicted Effect probably damaging
Transcript: ENSMUST00000026480
AA Change: L233H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026480
Gene: ENSMUSG00000025413
AA Change: L233H

DomainStartEndE-ValueType
TPR 79 112 1.26e1 SMART
TPR 117 150 7.27e0 SMART
TPR 151 184 3.07e1 SMART
low complexity region 235 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106772
SMART Domains Protein: ENSMUSP00000102384
Gene: ENSMUSG00000025413

DomainStartEndE-ValueType
TPR 79 112 1.26e1 SMART
TPR 117 150 7.27e0 SMART
TPR 151 184 3.07e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132650
Predicted Effect probably benign
Transcript: ENSMUST00000135676
SMART Domains Protein: ENSMUSP00000116620
Gene: ENSMUSG00000025413

DomainStartEndE-ValueType
Pfam:TPR_11 77 148 1.1e-14 PFAM
Pfam:TPR_1 79 109 8.2e-5 PFAM
Pfam:TPR_2 79 110 1.2e-3 PFAM
Blast:TPR 173 203 1e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142342
Meta Mutation Damage Score 0.1454 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains tetratricopeptide (TPR) repeats, which often mediate protein-protein interactions and chaperone activity. The encoded protein interacts with heat shock proteins 70 and 90. Alternative splicing results in multiple transcript variants. Naturally-occuring readthrough transcription occurs from upstream gene MROH (maestro heat-like repeat family member 7) to this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,770,438 A526D probably damaging Het
4930503E14Rik A T 14: 44,169,241 M117K possibly damaging Het
Adamts13 G A 2: 26,996,910 A1020T probably damaging Het
Atg3 C A 16: 45,178,232 D132E probably benign Het
Blzf1 A G 1: 164,306,468 M4T possibly damaging Het
Cdon G A 9: 35,478,639 R863Q probably damaging Het
Cyp2d40 C T 15: 82,760,259 R255H unknown Het
Evi5 T C 5: 107,821,874 K57R probably damaging Het
Fam186b T C 15: 99,280,686 E253G probably damaging Het
Fcgr1 A T 3: 96,285,884 F266I probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm10142 G T 10: 77,716,162 C119F probably damaging Het
Gpr63 A G 4: 25,008,202 S309G probably benign Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Jmy T A 13: 93,441,572 H696L possibly damaging Het
Kif13a T C 13: 46,788,085 H972R probably benign Het
Lama1 C T 17: 67,743,281 Q296* probably null Het
Lmf1 C T 17: 25,631,838 probably benign Het
Lpp T C 16: 24,971,846 C352R probably damaging Het
Ltbp1 T C 17: 75,292,886 probably benign Het
Maml3 G T 3: 51,690,841 D807E possibly damaging Het
Mdc1 T A 17: 35,847,844 V372D probably benign Het
Mst1 C A 9: 108,084,309 H579Q probably benign Het
Olfr1238 A G 2: 89,406,713 V122A probably damaging Het
Olfr26 G A 9: 38,855,289 V76I probably benign Het
Olfr398 T C 11: 73,984,378 T77A probably damaging Het
Olfr739 T C 14: 50,425,239 F240S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Phlpp2 A T 8: 109,913,619 H472L probably benign Het
Plscr3 A G 11: 69,850,091 probably null Het
Rab7 A T 6: 88,005,223 probably null Het
Rad50 A G 11: 53,674,696 probably null Het
Scgb1b20 A G 7: 33,373,312 probably null Het
Scn9a A C 2: 66,562,480 L256R probably damaging Het
Spag1 G T 15: 36,195,442 Q260H probably damaging Het
Tatdn3 T A 1: 191,046,278 I239F probably damaging Het
Tcof1 A G 18: 60,831,914 S578P possibly damaging Het
Top3b A G 16: 16,891,418 T657A probably benign Het
Tstd3 A G 4: 21,759,621 probably null Het
Vmn2r-ps130 T A 17: 23,063,820 M158K probably benign Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp976 A T 7: 42,613,419 C331* probably null Het
Other mutations in Ttc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Ttc4 APN 4 106671648 missense probably benign 0.00
IGL01109:Ttc4 APN 4 106663163 missense probably damaging 1.00
IGL01825:Ttc4 APN 4 106671619 splice site probably null
IGL02221:Ttc4 APN 4 106676596 critical splice donor site probably null
IGL03333:Ttc4 APN 4 106676631 missense probably benign 0.19
IGL03385:Ttc4 APN 4 106668200 missense probably benign 0.00
R0398:Ttc4 UTSW 4 106667573 splice site probably null
R1300:Ttc4 UTSW 4 106667566 missense probably damaging 1.00
R4250:Ttc4 UTSW 4 106665683 missense probably damaging 0.96
R5911:Ttc4 UTSW 4 106668043 missense probably damaging 0.96
R7313:Ttc4 UTSW 4 106678820 missense possibly damaging 0.54
R7874:Ttc4 UTSW 4 106665684 missense probably benign 0.40
R8341:Ttc4 UTSW 4 106665696 missense probably benign
Z1177:Ttc4 UTSW 4 106668170 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAACAGTACCTGGTGTCCTC -3'
(R):5'- TAGGGGCTATCATCCAAATAACTGG -3'

Sequencing Primer
(F):5'- GTACCTGGTGTCCTCATGAAAAGC -3'
(R):5'- TAACTGGTATCCACTGTACCAGG -3'
Posted On2016-06-15