Incidental Mutation 'R5047:Herc3'
ID394410
Institutional Source Beutler Lab
Gene Symbol Herc3
Ensembl Gene ENSMUSG00000029804
Gene Namehect domain and RLD 3
Synonyms5730409F18Rik
MMRRC Submission 042637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5047 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location58831465-58920398 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 58855760 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 137 (Q137*)
Ref Sequence ENSEMBL: ENSMUSP00000040025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031823] [ENSMUST00000041401] [ENSMUST00000126292] [ENSMUST00000203714]
Predicted Effect probably null
Transcript: ENSMUST00000031823
AA Change: Q137*
SMART Domains Protein: ENSMUSP00000031823
Gene: ENSMUSG00000029804
AA Change: Q137*

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 3.3e-11 PFAM
Pfam:RCC1 52 99 3.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 1.4e-16 PFAM
Pfam:RCC1_2 139 168 2.1e-9 PFAM
Pfam:RCC1 155 205 2.6e-16 PFAM
Pfam:RCC1_2 193 221 1.5e-9 PFAM
Pfam:RCC1 208 257 4.7e-17 PFAM
Pfam:RCC1_2 244 273 8e-9 PFAM
Pfam:RCC1 260 309 2.6e-16 PFAM
Pfam:RCC1_2 296 326 2.3e-7 PFAM
Pfam:RCC1 313 377 3.8e-9 PFAM
HECTc 721 913 2.08e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000041401
AA Change: Q137*
SMART Domains Protein: ENSMUSP00000040025
Gene: ENSMUSG00000029804
AA Change: Q137*

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.7e-11 PFAM
Pfam:RCC1 52 99 1.6e-15 PFAM
Pfam:RCC1_2 86 115 1.1e-10 PFAM
Pfam:RCC1 102 152 7.3e-16 PFAM
Pfam:RCC1_2 139 168 1.3e-9 PFAM
Pfam:RCC1 155 205 1.4e-16 PFAM
Pfam:RCC1_2 193 221 5e-10 PFAM
Pfam:RCC1 208 257 1.4e-16 PFAM
Pfam:RCC1_2 244 273 6.1e-8 PFAM
Pfam:RCC1 260 309 1.7e-14 PFAM
Pfam:RCC1_2 296 326 1.1e-7 PFAM
Pfam:RCC1 313 377 6.6e-11 PFAM
HECTc 721 1050 5.79e-157 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126292
SMART Domains Protein: ENSMUSP00000122401
Gene: ENSMUSG00000029804

DomainStartEndE-ValueType
Pfam:RCC1_2 36 65 1.5e-12 PFAM
Pfam:RCC1 52 77 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203714
SMART Domains Protein: ENSMUSP00000145273
Gene: ENSMUSG00000029804

DomainStartEndE-ValueType
Pfam:RCC1 1 49 1.2e-4 PFAM
Pfam:RCC1_2 36 65 1.8e-10 PFAM
Pfam:RCC1 52 76 7.2e-6 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the HERC ubiquitin ligase family. The encoded protein is located in the cytosol and binds ubiquitin via a HECT domain. Mutations in this gene have been associated with colorectal and gastric carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hair follicle bulge morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,770,438 A526D probably damaging Het
4930503E14Rik A T 14: 44,169,241 M117K possibly damaging Het
Adamts13 G A 2: 26,996,910 A1020T probably damaging Het
Atg3 C A 16: 45,178,232 D132E probably benign Het
Blzf1 A G 1: 164,306,468 M4T possibly damaging Het
Cdon G A 9: 35,478,639 R863Q probably damaging Het
Cyp2d40 C T 15: 82,760,259 R255H unknown Het
Evi5 T C 5: 107,821,874 K57R probably damaging Het
Fam186b T C 15: 99,280,686 E253G probably damaging Het
Fcgr1 A T 3: 96,285,884 F266I probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm10142 G T 10: 77,716,162 C119F probably damaging Het
Gpr63 A G 4: 25,008,202 S309G probably benign Het
Jmy T A 13: 93,441,572 H696L possibly damaging Het
Kif13a T C 13: 46,788,085 H972R probably benign Het
Lama1 C T 17: 67,743,281 Q296* probably null Het
Lmf1 C T 17: 25,631,838 probably benign Het
Lpp T C 16: 24,971,846 C352R probably damaging Het
Ltbp1 T C 17: 75,292,886 probably benign Het
Maml3 G T 3: 51,690,841 D807E possibly damaging Het
Mdc1 T A 17: 35,847,844 V372D probably benign Het
Mst1 C A 9: 108,084,309 H579Q probably benign Het
Olfr1238 A G 2: 89,406,713 V122A probably damaging Het
Olfr26 G A 9: 38,855,289 V76I probably benign Het
Olfr398 T C 11: 73,984,378 T77A probably damaging Het
Olfr739 T C 14: 50,425,239 F240S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Phlpp2 A T 8: 109,913,619 H472L probably benign Het
Plscr3 A G 11: 69,850,091 probably null Het
Rab7 A T 6: 88,005,223 probably null Het
Rad50 A G 11: 53,674,696 probably null Het
Scgb1b20 A G 7: 33,373,312 probably null Het
Scn9a A C 2: 66,562,480 L256R probably damaging Het
Spag1 G T 15: 36,195,442 Q260H probably damaging Het
Tatdn3 T A 1: 191,046,278 I239F probably damaging Het
Tcof1 A G 18: 60,831,914 S578P possibly damaging Het
Top3b A G 16: 16,891,418 T657A probably benign Het
Tstd3 A G 4: 21,759,621 probably null Het
Ttc4 A T 4: 106,668,238 L233H probably damaging Het
Vmn2r-ps130 T A 17: 23,063,820 M158K probably benign Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp976 A T 7: 42,613,419 C331* probably null Het
Other mutations in Herc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Herc3 APN 6 58874263 missense probably damaging 1.00
IGL00423:Herc3 APN 6 58868715 missense probably damaging 0.99
IGL00468:Herc3 APN 6 58918766 missense probably benign 0.04
IGL01153:Herc3 APN 6 58860336 missense probably benign 0.21
IGL01468:Herc3 APN 6 58854895 missense probably benign 0.00
IGL01696:Herc3 APN 6 58860386 missense possibly damaging 0.58
IGL01975:Herc3 APN 6 58916576 missense possibly damaging 0.91
IGL02797:Herc3 APN 6 58868694 missense probably benign
IGL02953:Herc3 APN 6 58857733 nonsense probably null
aegean UTSW 6 58855760 nonsense probably null
PIT4519001:Herc3 UTSW 6 58876811 missense probably damaging 1.00
R0019:Herc3 UTSW 6 58885065 splice site probably benign
R0019:Herc3 UTSW 6 58885065 splice site probably benign
R0025:Herc3 UTSW 6 58874308 missense probably damaging 1.00
R0025:Herc3 UTSW 6 58874308 missense probably damaging 1.00
R0268:Herc3 UTSW 6 58868628 splice site probably benign
R0334:Herc3 UTSW 6 58918817 missense probably damaging 1.00
R0344:Herc3 UTSW 6 58868628 splice site probably benign
R0853:Herc3 UTSW 6 58876564 missense probably damaging 1.00
R0927:Herc3 UTSW 6 58868763 missense possibly damaging 0.48
R1333:Herc3 UTSW 6 58887493 missense probably damaging 1.00
R1432:Herc3 UTSW 6 58916842 missense possibly damaging 0.49
R1450:Herc3 UTSW 6 58876515 nonsense probably null
R1594:Herc3 UTSW 6 58887584 unclassified probably benign
R1757:Herc3 UTSW 6 58916470 missense probably damaging 1.00
R1765:Herc3 UTSW 6 58888660 missense probably damaging 0.99
R1932:Herc3 UTSW 6 58876793 missense probably damaging 0.99
R1945:Herc3 UTSW 6 58887439 missense probably damaging 0.96
R1988:Herc3 UTSW 6 58884975 critical splice donor site probably null
R2172:Herc3 UTSW 6 58887437 missense probably damaging 1.00
R3080:Herc3 UTSW 6 58856646 splice site probably null
R3545:Herc3 UTSW 6 58856685 missense probably damaging 1.00
R3767:Herc3 UTSW 6 58862988 missense probably benign
R3767:Herc3 UTSW 6 58876602 missense probably benign 0.00
R3805:Herc3 UTSW 6 58916850 missense probably damaging 1.00
R3806:Herc3 UTSW 6 58916850 missense probably damaging 1.00
R4049:Herc3 UTSW 6 58876837 missense probably damaging 0.99
R4250:Herc3 UTSW 6 58916516 missense probably damaging 1.00
R4469:Herc3 UTSW 6 58876809 nonsense probably null
R4534:Herc3 UTSW 6 58860347 missense probably benign
R4573:Herc3 UTSW 6 58894113 missense possibly damaging 0.89
R4887:Herc3 UTSW 6 58887499 missense probably damaging 1.00
R5049:Herc3 UTSW 6 58894539 splice site probably null
R5062:Herc3 UTSW 6 58855760 nonsense probably null
R5063:Herc3 UTSW 6 58855760 nonsense probably null
R5288:Herc3 UTSW 6 58874278 missense probably damaging 0.99
R5297:Herc3 UTSW 6 58856641 missense probably damaging 1.00
R5386:Herc3 UTSW 6 58874278 missense probably damaging 0.99
R5435:Herc3 UTSW 6 58855806 missense probably damaging 1.00
R5576:Herc3 UTSW 6 58888725 missense probably benign 0.08
R5605:Herc3 UTSW 6 58857727 missense probably damaging 1.00
R5719:Herc3 UTSW 6 58894543 missense possibly damaging 0.67
R5743:Herc3 UTSW 6 58918799 missense probably benign 0.12
R5870:Herc3 UTSW 6 58916450 missense probably benign 0.01
R6460:Herc3 UTSW 6 58890123 missense probably damaging 1.00
R6930:Herc3 UTSW 6 58916459 missense probably damaging 0.98
R7034:Herc3 UTSW 6 58876855 missense probably benign 0.00
R7131:Herc3 UTSW 6 58887424 missense probably damaging 1.00
R7187:Herc3 UTSW 6 58856631 missense probably benign 0.42
R7212:Herc3 UTSW 6 58918773 missense probably damaging 1.00
R7335:Herc3 UTSW 6 58876788 missense possibly damaging 0.95
R7349:Herc3 UTSW 6 58858986 missense probably benign
R7568:Herc3 UTSW 6 58843810 missense probably benign 0.01
R7857:Herc3 UTSW 6 58843652 nonsense probably null
R8321:Herc3 UTSW 6 58843769 missense possibly damaging 0.93
Z1176:Herc3 UTSW 6 58843858 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTAAGCTCTTAAGAGTCAGCC -3'
(R):5'- ACATCTCCAAGAAAGGATGCG -3'

Sequencing Primer
(F):5'- AGCTCTTAAGAGTCAGCCTAATG -3'
(R):5'- TCTCCAAGAAAGGATGCGATACACAG -3'
Posted On2016-06-15