Incidental Mutation 'R5047:Rab7'
ID394411
Institutional Source Beutler Lab
Gene Symbol Rab7
Ensembl Gene ENSMUSG00000079477
Gene NameRAB7, member RAS oncogene family
Synonyms
MMRRC Submission 042637-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.853) question?
Stock #R5047 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location87999106-88045270 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 88005223 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095048] [ENSMUST00000113596] [ENSMUST00000113597] [ENSMUST00000113598] [ENSMUST00000113600] [ENSMUST00000203674] [ENSMUST00000204126]
Predicted Effect probably null
Transcript: ENSMUST00000095048
SMART Domains Protein: ENSMUSP00000092658
Gene: ENSMUSG00000079477

DomainStartEndE-ValueType
RAB 9 176 9.3e-97 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113596
SMART Domains Protein: ENSMUSP00000109226
Gene: ENSMUSG00000079477

DomainStartEndE-ValueType
RAB 9 176 9.3e-97 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113597
SMART Domains Protein: ENSMUSP00000109227
Gene: ENSMUSG00000079477

DomainStartEndE-ValueType
RAB 9 176 9.3e-97 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113598
SMART Domains Protein: ENSMUSP00000109228
Gene: ENSMUSG00000079477

DomainStartEndE-ValueType
RAB 9 176 9.3e-97 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113600
SMART Domains Protein: ENSMUSP00000109230
Gene: ENSMUSG00000079477

DomainStartEndE-ValueType
RAB 9 176 9.3e-97 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153372
SMART Domains Protein: ENSMUSP00000122496
Gene: ENSMUSG00000084950

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
low complexity region 65 86 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203674
SMART Domains Protein: ENSMUSP00000145215
Gene: ENSMUSG00000079477

DomainStartEndE-ValueType
small_GTPase 6 87 3.5e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000204126
SMART Domains Protein: ENSMUSP00000145097
Gene: ENSMUSG00000079477

DomainStartEndE-ValueType
small_GTPase 6 99 6.6e-6 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted alleles exhibit abnormal endocytosis within the visceral endoderm, failure of elongation along the primitive streak and incomplete gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,770,438 A526D probably damaging Het
4930503E14Rik A T 14: 44,169,241 M117K possibly damaging Het
Adamts13 G A 2: 26,996,910 A1020T probably damaging Het
Atg3 C A 16: 45,178,232 D132E probably benign Het
Blzf1 A G 1: 164,306,468 M4T possibly damaging Het
Cdon G A 9: 35,478,639 R863Q probably damaging Het
Cyp2d40 C T 15: 82,760,259 R255H unknown Het
Evi5 T C 5: 107,821,874 K57R probably damaging Het
Fam186b T C 15: 99,280,686 E253G probably damaging Het
Fcgr1 A T 3: 96,285,884 F266I probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm10142 G T 10: 77,716,162 C119F probably damaging Het
Gpr63 A G 4: 25,008,202 S309G probably benign Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Jmy T A 13: 93,441,572 H696L possibly damaging Het
Kif13a T C 13: 46,788,085 H972R probably benign Het
Lama1 C T 17: 67,743,281 Q296* probably null Het
Lmf1 C T 17: 25,631,838 probably benign Het
Lpp T C 16: 24,971,846 C352R probably damaging Het
Ltbp1 T C 17: 75,292,886 probably benign Het
Maml3 G T 3: 51,690,841 D807E possibly damaging Het
Mdc1 T A 17: 35,847,844 V372D probably benign Het
Mst1 C A 9: 108,084,309 H579Q probably benign Het
Olfr1238 A G 2: 89,406,713 V122A probably damaging Het
Olfr26 G A 9: 38,855,289 V76I probably benign Het
Olfr398 T C 11: 73,984,378 T77A probably damaging Het
Olfr739 T C 14: 50,425,239 F240S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Phlpp2 A T 8: 109,913,619 H472L probably benign Het
Plscr3 A G 11: 69,850,091 probably null Het
Rad50 A G 11: 53,674,696 probably null Het
Scgb1b20 A G 7: 33,373,312 probably null Het
Scn9a A C 2: 66,562,480 L256R probably damaging Het
Spag1 G T 15: 36,195,442 Q260H probably damaging Het
Tatdn3 T A 1: 191,046,278 I239F probably damaging Het
Tcof1 A G 18: 60,831,914 S578P possibly damaging Het
Top3b A G 16: 16,891,418 T657A probably benign Het
Tstd3 A G 4: 21,759,621 probably null Het
Ttc4 A T 4: 106,668,238 L233H probably damaging Het
Vmn2r-ps130 T A 17: 23,063,820 M158K probably benign Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp976 A T 7: 42,613,419 C331* probably null Het
Other mutations in Rab7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0242:Rab7 UTSW 6 88005132 missense probably damaging 0.98
R0242:Rab7 UTSW 6 88005132 missense probably damaging 0.98
R1029:Rab7 UTSW 6 88013642 missense probably damaging 1.00
R2025:Rab7 UTSW 6 88004179 missense probably damaging 1.00
R2086:Rab7 UTSW 6 88012318 missense probably benign 0.08
R2177:Rab7 UTSW 6 88005081 missense probably damaging 1.00
R5564:Rab7 UTSW 6 88013650 missense probably damaging 1.00
R7491:Rab7 UTSW 6 88013642 missense probably damaging 1.00
R8263:Rab7 UTSW 6 88012310 missense probably benign 0.01
R8513:Rab7 UTSW 6 88004268 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CAAAAGGGAAGTTCTCGGGATC -3'
(R):5'- ACTGCTTGCTTCAACTCCAG -3'

Sequencing Primer
(F):5'- AAACTCGTCTCTCCAGCT -3'
(R):5'- TTTAGCCTATAATCCCAACACCCAGG -3'
Posted On2016-06-15