Incidental Mutation 'R5047:Cdon'
ID394415
Institutional Source Beutler Lab
Gene Symbol Cdon
Ensembl Gene ENSMUSG00000038119
Gene Namecell adhesion molecule-related/down-regulated by oncogenes
SynonymsCDO, CAM-related/down-regulated by oncogenes
MMRRC Submission 042637-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.356) question?
Stock #R5047 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location35421128-35507652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35478639 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 863 (R863Q)
Ref Sequence ENSEMBL: ENSMUSP00000113977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042842] [ENSMUST00000119129]
Predicted Effect probably damaging
Transcript: ENSMUST00000042842
AA Change: R863Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045547
Gene: ENSMUSG00000038119
AA Change: R863Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084000
Predicted Effect probably damaging
Transcript: ENSMUST00000119129
AA Change: R863Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113977
Gene: ENSMUSG00000038119
AA Change: R863Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Meta Mutation Damage Score 0.2537 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor that is a member of the immunoglobulin superfamily. The encoded protein contains three fibronectin type III domains and five immunoglobulin-like C2-type domains. This protein is a member of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells and positively regulates myogenesis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice display facial defects characteristic of microform holoprosencephaly, are runted, and are prone to death prior to weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,770,438 A526D probably damaging Het
4930503E14Rik A T 14: 44,169,241 M117K possibly damaging Het
Adamts13 G A 2: 26,996,910 A1020T probably damaging Het
Atg3 C A 16: 45,178,232 D132E probably benign Het
Blzf1 A G 1: 164,306,468 M4T possibly damaging Het
Cyp2d40 C T 15: 82,760,259 R255H unknown Het
Evi5 T C 5: 107,821,874 K57R probably damaging Het
Fam186b T C 15: 99,280,686 E253G probably damaging Het
Fcgr1 A T 3: 96,285,884 F266I probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm10142 G T 10: 77,716,162 C119F probably damaging Het
Gpr63 A G 4: 25,008,202 S309G probably benign Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Jmy T A 13: 93,441,572 H696L possibly damaging Het
Kif13a T C 13: 46,788,085 H972R probably benign Het
Lama1 C T 17: 67,743,281 Q296* probably null Het
Lmf1 C T 17: 25,631,838 probably benign Het
Lpp T C 16: 24,971,846 C352R probably damaging Het
Ltbp1 T C 17: 75,292,886 probably benign Het
Maml3 G T 3: 51,690,841 D807E possibly damaging Het
Mdc1 T A 17: 35,847,844 V372D probably benign Het
Mst1 C A 9: 108,084,309 H579Q probably benign Het
Olfr1238 A G 2: 89,406,713 V122A probably damaging Het
Olfr26 G A 9: 38,855,289 V76I probably benign Het
Olfr398 T C 11: 73,984,378 T77A probably damaging Het
Olfr739 T C 14: 50,425,239 F240S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Phlpp2 A T 8: 109,913,619 H472L probably benign Het
Plscr3 A G 11: 69,850,091 probably null Het
Rab7 A T 6: 88,005,223 probably null Het
Rad50 A G 11: 53,674,696 probably null Het
Scgb1b20 A G 7: 33,373,312 probably null Het
Scn9a A C 2: 66,562,480 L256R probably damaging Het
Spag1 G T 15: 36,195,442 Q260H probably damaging Het
Tatdn3 T A 1: 191,046,278 I239F probably damaging Het
Tcof1 A G 18: 60,831,914 S578P possibly damaging Het
Top3b A G 16: 16,891,418 T657A probably benign Het
Tstd3 A G 4: 21,759,621 probably null Het
Ttc4 A T 4: 106,668,238 L233H probably damaging Het
Vmn2r-ps130 T A 17: 23,063,820 M158K probably benign Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp976 A T 7: 42,613,419 C331* probably null Het
Other mutations in Cdon
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Cdon APN 9 35478116 missense probably damaging 1.00
IGL01307:Cdon APN 9 35457564 missense probably benign 0.01
IGL01528:Cdon APN 9 35470107 missense possibly damaging 0.95
IGL01663:Cdon APN 9 35483214 missense possibly damaging 0.57
IGL01723:Cdon APN 9 35503338 missense probably benign 0.05
IGL02200:Cdon APN 9 35483109 missense probably benign 0.28
IGL02444:Cdon APN 9 35473448 missense probably benign 0.09
IGL02547:Cdon APN 9 35478654 missense probably damaging 1.00
IGL02620:Cdon APN 9 35452799 missense probably benign 0.00
IGL02861:Cdon APN 9 35486957 missense probably damaging 0.96
IGL02894:Cdon APN 9 35455426 missense probably benign 0.01
IGL03153:Cdon APN 9 35477959 missense probably damaging 1.00
IGL03206:Cdon APN 9 35503306 missense probably benign
IGL03374:Cdon APN 9 35478003 missense possibly damaging 0.46
indentured UTSW 9 35452106 start codon destroyed probably null 1.00
Molar UTSW 9 35463895 missense probably benign 0.15
Servitude UTSW 9 35476948 missense probably damaging 1.00
PIT4280001:Cdon UTSW 9 35486935 missense probably damaging 1.00
R0045:Cdon UTSW 9 35486807 missense probably benign
R0045:Cdon UTSW 9 35486807 missense probably benign
R0064:Cdon UTSW 9 35489227 missense probably benign 0.03
R0396:Cdon UTSW 9 35470130 missense probably damaging 1.00
R0403:Cdon UTSW 9 35473500 missense probably benign 0.00
R0490:Cdon UTSW 9 35452682 missense probably damaging 1.00
R0547:Cdon UTSW 9 35457498 missense possibly damaging 0.88
R0609:Cdon UTSW 9 35478611 missense probably damaging 1.00
R0645:Cdon UTSW 9 35477083 splice site probably null
R0781:Cdon UTSW 9 35456437 splice site probably benign
R1110:Cdon UTSW 9 35456437 splice site probably benign
R1391:Cdon UTSW 9 35504189 missense possibly damaging 0.51
R1574:Cdon UTSW 9 35452937 splice site probably benign
R1851:Cdon UTSW 9 35483158 missense probably damaging 1.00
R2031:Cdon UTSW 9 35504074 missense probably damaging 0.96
R2230:Cdon UTSW 9 35491926 critical splice donor site probably null
R3683:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3684:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3685:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3941:Cdon UTSW 9 35464171 missense probably benign 0.09
R4030:Cdon UTSW 9 35491906 missense probably damaging 1.00
R4084:Cdon UTSW 9 35478131 missense probably damaging 0.98
R4462:Cdon UTSW 9 35457580 missense probably damaging 0.97
R4569:Cdon UTSW 9 35476969 missense probably damaging 1.00
R4677:Cdon UTSW 9 35478605 missense probably damaging 1.00
R4869:Cdon UTSW 9 35452904 missense possibly damaging 0.71
R5032:Cdon UTSW 9 35489034 missense probably damaging 1.00
R5214:Cdon UTSW 9 35483208 missense probably damaging 1.00
R5341:Cdon UTSW 9 35470135 missense probably damaging 1.00
R5410:Cdon UTSW 9 35470035 missense probably damaging 0.99
R5581:Cdon UTSW 9 35504081 missense probably benign 0.01
R5696:Cdon UTSW 9 35491866 missense possibly damaging 0.69
R5757:Cdon UTSW 9 35452772 missense probably damaging 0.98
R5802:Cdon UTSW 9 35454420 missense probably damaging 0.99
R5845:Cdon UTSW 9 35457466 missense probably damaging 1.00
R5949:Cdon UTSW 9 35486951 missense probably benign 0.32
R6106:Cdon UTSW 9 35455408 nonsense probably null
R6245:Cdon UTSW 9 35476939 missense probably damaging 1.00
R6845:Cdon UTSW 9 35486956 nonsense probably null
R6896:Cdon UTSW 9 35452106 start codon destroyed probably null 1.00
R7060:Cdon UTSW 9 35486909 missense probably damaging 1.00
R7076:Cdon UTSW 9 35504150 missense probably benign 0.00
R7184:Cdon UTSW 9 35463895 missense probably benign 0.15
R7382:Cdon UTSW 9 35478648 missense probably damaging 1.00
R7763:Cdon UTSW 9 35454415 nonsense probably null
R7857:Cdon UTSW 9 35456612 missense possibly damaging 0.79
R7885:Cdon UTSW 9 35456522 missense probably benign 0.01
R7894:Cdon UTSW 9 35476948 missense probably damaging 1.00
R7984:Cdon UTSW 9 35503302 missense probably benign 0.00
R8287:Cdon UTSW 9 35463929 missense probably benign
R8428:Cdon UTSW 9 35491867 missense probably benign 0.21
Z1177:Cdon UTSW 9 35491900 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCTCATCCAAATGGTGC -3'
(R):5'- CAAAATCAGGGCACTGTCGC -3'

Sequencing Primer
(F):5'- CTCTCATCCAAATGGTGCTAATTAAC -3'
(R):5'- GAGACTGGGAAATTTGGATTACATG -3'
Posted On2016-06-15