Incidental Mutation 'R5047:Mst1'
ID394417
Institutional Source Beutler Lab
Gene Symbol Mst1
Ensembl Gene ENSMUSG00000032591
Gene Namemacrophage stimulating 1 (hepatocyte growth factor-like)
SynonymsD9H3F15S2, DNF15S2h, D3F15S2h, Hgfl
MMRRC Submission 042637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5047 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108080436-108085003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108084309 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 579 (H579Q)
Ref Sequence ENSEMBL: ENSMUSP00000125175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035211] [ENSMUST00000159372] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162886] [ENSMUST00000178267] [ENSMUST00000193254]
Predicted Effect probably benign
Transcript: ENSMUST00000035211
AA Change: H588Q

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000035211
Gene: ENSMUSG00000032591
AA Change: H588Q

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 8.57e-46 SMART
KR 290 372 7.94e-41 SMART
KR 377 459 6.59e-47 SMART
Tryp_SPc 488 709 2.27e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081309
SMART Domains Protein: ENSMUSP00000080058
Gene: ENSMUSG00000032590

DomainStartEndE-ValueType
Pfam:DLH 485 721 2e-8 PFAM
Pfam:Abhydrolase_1 501 633 3.8e-9 PFAM
Pfam:Abhydrolase_5 501 708 5e-16 PFAM
Pfam:Peptidase_S9 516 732 1.6e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect probably benign
Transcript: ENSMUST00000159372
Predicted Effect probably benign
Transcript: ENSMUST00000160184
Predicted Effect probably benign
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161253
AA Change: H1Q
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect probably benign
Transcript: ENSMUST00000162886
AA Change: H579Q

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125175
Gene: ENSMUSG00000032591
AA Change: H579Q

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 1.07e-46 SMART
KR 281 363 7.94e-41 SMART
KR 368 450 6.59e-47 SMART
Tryp_SPc 479 700 2.27e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192916
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194014
Predicted Effect probably benign
Transcript: ENSMUST00000193254
SMART Domains Protein: ENSMUSP00000141856
Gene: ENSMUSG00000032590

DomainStartEndE-ValueType
Pfam:DLH 485 721 4.8e-8 PFAM
Pfam:Abhydrolase_5 501 708 5.7e-16 PFAM
Pfam:Abhydrolase_6 503 714 6.2e-14 PFAM
Pfam:Peptidase_S9 515 732 1.4e-38 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains four kringle domains and a serine protease domain, similar to that found in hepatic growth factor. Despite the presence of the serine protease domain, the encoded protein may not have any proteolytic activity. The receptor for this protein is RON tyrosine kinase, which upon activation stimulates ciliary motility of ciliated epithelial lung cells. This protein is secreted and cleaved to form an alpha chain and a beta chain bridged by disulfide bonds. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lipid-filled cytoplasmic vacuoles in hepatocytes throughout the liver lobules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,770,438 A526D probably damaging Het
4930503E14Rik A T 14: 44,169,241 M117K possibly damaging Het
Adamts13 G A 2: 26,996,910 A1020T probably damaging Het
Atg3 C A 16: 45,178,232 D132E probably benign Het
Blzf1 A G 1: 164,306,468 M4T possibly damaging Het
Cdon G A 9: 35,478,639 R863Q probably damaging Het
Cyp2d40 C T 15: 82,760,259 R255H unknown Het
Evi5 T C 5: 107,821,874 K57R probably damaging Het
Fam186b T C 15: 99,280,686 E253G probably damaging Het
Fcgr1 A T 3: 96,285,884 F266I probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm10142 G T 10: 77,716,162 C119F probably damaging Het
Gpr63 A G 4: 25,008,202 S309G probably benign Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Jmy T A 13: 93,441,572 H696L possibly damaging Het
Kif13a T C 13: 46,788,085 H972R probably benign Het
Lama1 C T 17: 67,743,281 Q296* probably null Het
Lmf1 C T 17: 25,631,838 probably benign Het
Lpp T C 16: 24,971,846 C352R probably damaging Het
Ltbp1 T C 17: 75,292,886 probably benign Het
Maml3 G T 3: 51,690,841 D807E possibly damaging Het
Mdc1 T A 17: 35,847,844 V372D probably benign Het
Olfr1238 A G 2: 89,406,713 V122A probably damaging Het
Olfr26 G A 9: 38,855,289 V76I probably benign Het
Olfr398 T C 11: 73,984,378 T77A probably damaging Het
Olfr739 T C 14: 50,425,239 F240S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Phlpp2 A T 8: 109,913,619 H472L probably benign Het
Plscr3 A G 11: 69,850,091 probably null Het
Rab7 A T 6: 88,005,223 probably null Het
Rad50 A G 11: 53,674,696 probably null Het
Scgb1b20 A G 7: 33,373,312 probably null Het
Scn9a A C 2: 66,562,480 L256R probably damaging Het
Spag1 G T 15: 36,195,442 Q260H probably damaging Het
Tatdn3 T A 1: 191,046,278 I239F probably damaging Het
Tcof1 A G 18: 60,831,914 S578P possibly damaging Het
Top3b A G 16: 16,891,418 T657A probably benign Het
Tstd3 A G 4: 21,759,621 probably null Het
Ttc4 A T 4: 106,668,238 L233H probably damaging Het
Vmn2r-ps130 T A 17: 23,063,820 M158K probably benign Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp976 A T 7: 42,613,419 C331* probably null Het
Other mutations in Mst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Mst1 APN 9 108081601 missense probably benign 0.03
IGL01380:Mst1 APN 9 108084588 missense probably damaging 1.00
IGL01420:Mst1 APN 9 108082828 missense probably damaging 0.99
IGL02931:Mst1 APN 9 108084642 splice site probably null
IGL03059:Mst1 APN 9 108084813 missense probably damaging 1.00
IGL03275:Mst1 APN 9 108084388 missense possibly damaging 0.70
R0319:Mst1 UTSW 9 108082513 missense probably benign 0.05
R0361:Mst1 UTSW 9 108084897 missense probably damaging 0.98
R0412:Mst1 UTSW 9 108083594 missense probably benign 0.06
R0569:Mst1 UTSW 9 108082301 missense probably damaging 0.98
R1432:Mst1 UTSW 9 108084204 missense probably benign 0.01
R1483:Mst1 UTSW 9 108081650 missense probably benign 0.03
R1859:Mst1 UTSW 9 108084346 missense probably benign 0.23
R2187:Mst1 UTSW 9 108084340 missense possibly damaging 0.63
R2393:Mst1 UTSW 9 108082952 critical splice donor site probably null
R3522:Mst1 UTSW 9 108081503 unclassified probably benign
R3916:Mst1 UTSW 9 108084295 missense probably benign 0.00
R3917:Mst1 UTSW 9 108084295 missense probably benign 0.00
R3945:Mst1 UTSW 9 108084853 missense probably damaging 1.00
R4006:Mst1 UTSW 9 108082948 missense possibly damaging 0.52
R4007:Mst1 UTSW 9 108082948 missense possibly damaging 0.52
R4737:Mst1 UTSW 9 108080521 missense probably benign 0.00
R4756:Mst1 UTSW 9 108083627 missense probably benign 0.28
R5113:Mst1 UTSW 9 108082247 missense probably damaging 1.00
R5278:Mst1 UTSW 9 108082215 missense probably damaging 0.99
R5279:Mst1 UTSW 9 108082215 missense probably damaging 0.99
R5402:Mst1 UTSW 9 108084209 critical splice donor site probably null
R5677:Mst1 UTSW 9 108081286 missense probably damaging 0.98
R5712:Mst1 UTSW 9 108082908 missense probably damaging 1.00
R6717:Mst1 UTSW 9 108080575 splice site probably null
R7059:Mst1 UTSW 9 108084064 missense probably benign 0.44
R7131:Mst1 UTSW 9 108084931 missense probably null 0.07
R7139:Mst1 UTSW 9 108082828 missense probably damaging 0.99
R7219:Mst1 UTSW 9 108081286 missense probably damaging 0.99
R7501:Mst1 UTSW 9 108082549 missense probably damaging 1.00
R7878:Mst1 UTSW 9 108084613 missense probably benign
R8304:Mst1 UTSW 9 108081604 missense probably benign
R8397:Mst1 UTSW 9 108081499 critical splice donor site probably benign
X0028:Mst1 UTSW 9 108082217 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTGGGTACAATTAACCAGAACCC -3'
(R):5'- ATCGAGGCCACATGAAGGAC -3'

Sequencing Primer
(F):5'- GAACCCACAGCCTGGAGAG -3'
(R):5'- CCACATGAAGGACTGTGTTATTGC -3'
Posted On2016-06-15