Incidental Mutation 'R5047:Gm10142'
ID394418
Institutional Source Beutler Lab
Gene Symbol Gm10142
Ensembl Gene ENSMUSG00000094146
Gene Namepredicted gene 10142
Synonyms
MMRRC Submission 042637-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5047 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location77715807-77716169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 77716162 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 119 (C119F)
Ref Sequence ENSEMBL: ENSMUSP00000135962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075421] [ENSMUST00000092366] [ENSMUST00000092370] [ENSMUST00000179767]
Predicted Effect probably benign
Transcript: ENSMUST00000075421
SMART Domains Protein: ENSMUSP00000074876
Gene: ENSMUSG00000094012

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 53 2.6e-8 PFAM
Pfam:Keratin_B2_2 29 74 9.2e-10 PFAM
low complexity region 92 105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092366
SMART Domains Protein: ENSMUSP00000090020
Gene: ENSMUSG00000069581

DomainStartEndE-ValueType
Blast:TSPN 1 71 8e-40 BLAST
SCOP:d1c4ra_ 2 67 2e-7 SMART
low complexity region 190 200 N/A INTRINSIC
Pfam:EPTP 208 255 2.6e-22 PFAM
Pfam:EPTP 260 307 1.4e-21 PFAM
Pfam:EPTP 312 359 8.9e-14 PFAM
Pfam:EPTP 362 417 6.2e-13 PFAM
Pfam:EPTP 422 469 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092370
SMART Domains Protein: ENSMUSP00000090024
Gene: ENSMUSG00000069583

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 42 3.1e-6 PFAM
Pfam:Keratin_B2_2 20 68 3.1e-10 PFAM
Pfam:Keratin_B2_2 39 84 3.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179767
AA Change: C119F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135962
Gene: ENSMUSG00000094146
AA Change: C119F

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 53 1.7e-8 PFAM
Pfam:Keratin_B2_2 29 74 1.8e-9 PFAM
low complexity region 88 106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218482
Meta Mutation Damage Score 0.3942 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,770,438 A526D probably damaging Het
4930503E14Rik A T 14: 44,169,241 M117K possibly damaging Het
Adamts13 G A 2: 26,996,910 A1020T probably damaging Het
Atg3 C A 16: 45,178,232 D132E probably benign Het
Blzf1 A G 1: 164,306,468 M4T possibly damaging Het
Cdon G A 9: 35,478,639 R863Q probably damaging Het
Cyp2d40 C T 15: 82,760,259 R255H unknown Het
Evi5 T C 5: 107,821,874 K57R probably damaging Het
Fam186b T C 15: 99,280,686 E253G probably damaging Het
Fcgr1 A T 3: 96,285,884 F266I probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gpr63 A G 4: 25,008,202 S309G probably benign Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Jmy T A 13: 93,441,572 H696L possibly damaging Het
Kif13a T C 13: 46,788,085 H972R probably benign Het
Lama1 C T 17: 67,743,281 Q296* probably null Het
Lmf1 C T 17: 25,631,838 probably benign Het
Lpp T C 16: 24,971,846 C352R probably damaging Het
Ltbp1 T C 17: 75,292,886 probably benign Het
Maml3 G T 3: 51,690,841 D807E possibly damaging Het
Mdc1 T A 17: 35,847,844 V372D probably benign Het
Mst1 C A 9: 108,084,309 H579Q probably benign Het
Olfr1238 A G 2: 89,406,713 V122A probably damaging Het
Olfr26 G A 9: 38,855,289 V76I probably benign Het
Olfr398 T C 11: 73,984,378 T77A probably damaging Het
Olfr739 T C 14: 50,425,239 F240S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Phlpp2 A T 8: 109,913,619 H472L probably benign Het
Plscr3 A G 11: 69,850,091 probably null Het
Rab7 A T 6: 88,005,223 probably null Het
Rad50 A G 11: 53,674,696 probably null Het
Scgb1b20 A G 7: 33,373,312 probably null Het
Scn9a A C 2: 66,562,480 L256R probably damaging Het
Spag1 G T 15: 36,195,442 Q260H probably damaging Het
Tatdn3 T A 1: 191,046,278 I239F probably damaging Het
Tcof1 A G 18: 60,831,914 S578P possibly damaging Het
Top3b A G 16: 16,891,418 T657A probably benign Het
Tstd3 A G 4: 21,759,621 probably null Het
Ttc4 A T 4: 106,668,238 L233H probably damaging Het
Vmn2r-ps130 T A 17: 23,063,820 M158K probably benign Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp976 A T 7: 42,613,419 C331* probably null Het
Other mutations in Gm10142
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02369:Gm10142 APN 10 77716113 missense probably benign 0.07
R0244:Gm10142 UTSW 10 77716014 splice site probably null
R1293:Gm10142 UTSW 10 77716035 missense probably benign 0.03
R1918:Gm10142 UTSW 10 77715987 missense probably benign 0.32
R5814:Gm10142 UTSW 10 77716123 missense probably damaging 0.99
R8248:Gm10142 UTSW 10 77716116 missense probably damaging 0.96
R8279:Gm10142 UTSW 10 77716167 makesense probably null
Predicted Primers PCR Primer
(F):5'- ATACCAAGTGGCCTGCTGTG -3'
(R):5'- GTAAAGAGACATTCCCAGAGCC -3'

Sequencing Primer
(F):5'- GTGCCTGTGAGCTGCAG -3'
(R):5'- AGAGCCACGGTACCCTTTCAG -3'
Posted On2016-06-15