Incidental Mutation 'R5047:Kif13a'
ID394420
Institutional Source Beutler Lab
Gene Symbol Kif13a
Ensembl Gene ENSMUSG00000021375
Gene Namekinesin family member 13A
Synonyms4930505I07Rik, N-3 kinesin
MMRRC Submission 042637-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R5047 (G1)
Quality Score165
Status Validated
Chromosome13
Chromosomal Location46749087-46929867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46788085 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 972 (H972R)
Ref Sequence ENSEMBL: ENSMUSP00000055304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000223881] [ENSMUST00000225591]
Predicted Effect probably benign
Transcript: ENSMUST00000056978
AA Change: H972R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: H972R

DomainStartEndE-ValueType
KISc 3 360 2.69e-175 SMART
low complexity region 368 381 N/A INTRINSIC
low complexity region 391 406 N/A INTRINSIC
FHA 469 519 7.16e-2 SMART
coiled coil region 605 639 N/A INTRINSIC
coiled coil region 664 704 N/A INTRINSIC
Pfam:KIF1B 748 792 1.7e-19 PFAM
low complexity region 840 854 N/A INTRINSIC
low complexity region 903 915 N/A INTRINSIC
Pfam:DUF3694 1003 1270 2.2e-39 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1475 1492 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000223856
AA Change: H42R
Predicted Effect probably benign
Transcript: ENSMUST00000223881
Predicted Effect unknown
Transcript: ENSMUST00000224756
AA Change: H80R
Predicted Effect probably benign
Transcript: ENSMUST00000225591
AA Change: H909R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225904
Meta Mutation Damage Score 0.0730 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,770,438 A526D probably damaging Het
4930503E14Rik A T 14: 44,169,241 M117K possibly damaging Het
Adamts13 G A 2: 26,996,910 A1020T probably damaging Het
Atg3 C A 16: 45,178,232 D132E probably benign Het
Blzf1 A G 1: 164,306,468 M4T possibly damaging Het
Cdon G A 9: 35,478,639 R863Q probably damaging Het
Cyp2d40 C T 15: 82,760,259 R255H unknown Het
Evi5 T C 5: 107,821,874 K57R probably damaging Het
Fam186b T C 15: 99,280,686 E253G probably damaging Het
Fcgr1 A T 3: 96,285,884 F266I probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm10142 G T 10: 77,716,162 C119F probably damaging Het
Gpr63 A G 4: 25,008,202 S309G probably benign Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Jmy T A 13: 93,441,572 H696L possibly damaging Het
Lama1 C T 17: 67,743,281 Q296* probably null Het
Lmf1 C T 17: 25,631,838 probably benign Het
Lpp T C 16: 24,971,846 C352R probably damaging Het
Ltbp1 T C 17: 75,292,886 probably benign Het
Maml3 G T 3: 51,690,841 D807E possibly damaging Het
Mdc1 T A 17: 35,847,844 V372D probably benign Het
Mst1 C A 9: 108,084,309 H579Q probably benign Het
Olfr1238 A G 2: 89,406,713 V122A probably damaging Het
Olfr26 G A 9: 38,855,289 V76I probably benign Het
Olfr398 T C 11: 73,984,378 T77A probably damaging Het
Olfr739 T C 14: 50,425,239 F240S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Phlpp2 A T 8: 109,913,619 H472L probably benign Het
Plscr3 A G 11: 69,850,091 probably null Het
Rab7 A T 6: 88,005,223 probably null Het
Rad50 A G 11: 53,674,696 probably null Het
Scgb1b20 A G 7: 33,373,312 probably null Het
Scn9a A C 2: 66,562,480 L256R probably damaging Het
Spag1 G T 15: 36,195,442 Q260H probably damaging Het
Tatdn3 T A 1: 191,046,278 I239F probably damaging Het
Tcof1 A G 18: 60,831,914 S578P possibly damaging Het
Top3b A G 16: 16,891,418 T657A probably benign Het
Tstd3 A G 4: 21,759,621 probably null Het
Ttc4 A T 4: 106,668,238 L233H probably damaging Het
Vmn2r-ps130 T A 17: 23,063,820 M158K probably benign Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp976 A T 7: 42,613,419 C331* probably null Het
Other mutations in Kif13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Kif13a APN 13 46750634 splice site probably benign
IGL01433:Kif13a APN 13 46772908 missense probably damaging 1.00
IGL01528:Kif13a APN 13 46864837 splice site probably benign
IGL01536:Kif13a APN 13 46752289 missense probably damaging 0.96
IGL01620:Kif13a APN 13 46864820 missense probably benign
IGL02020:Kif13a APN 13 46794019 missense probably benign 0.05
IGL02142:Kif13a APN 13 46771535 missense probably benign 0.04
IGL02375:Kif13a APN 13 46825222 missense probably damaging 1.00
IGL02407:Kif13a APN 13 46785293 missense probably damaging 0.99
IGL02476:Kif13a APN 13 46785296 missense probably damaging 1.00
IGL03038:Kif13a APN 13 46772838 missense probably damaging 1.00
IGL03053:Kif13a APN 13 46752088 missense probably benign 0.01
IGL03366:Kif13a APN 13 46764623 missense probably benign 0.00
R0025:Kif13a UTSW 13 46786511 critical splice donor site probably null
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0106:Kif13a UTSW 13 46825347 splice site probably benign
R0135:Kif13a UTSW 13 46793943 missense probably damaging 0.99
R0137:Kif13a UTSW 13 46764603 missense probably benign 0.38
R0243:Kif13a UTSW 13 46791351 missense probably benign 0.24
R0346:Kif13a UTSW 13 46814219 missense possibly damaging 0.95
R0403:Kif13a UTSW 13 46791401 missense probably damaging 1.00
R0492:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0607:Kif13a UTSW 13 46802711 missense probably damaging 0.96
R0631:Kif13a UTSW 13 46778888 unclassified probably benign
R0654:Kif13a UTSW 13 46812742 missense possibly damaging 0.93
R0697:Kif13a UTSW 13 46848337 missense probably benign 0.19
R0699:Kif13a UTSW 13 46799213 missense possibly damaging 0.92
R0715:Kif13a UTSW 13 46812823 missense probably damaging 0.98
R0834:Kif13a UTSW 13 46814236 missense probably damaging 0.96
R0903:Kif13a UTSW 13 46929259 missense possibly damaging 0.75
R1419:Kif13a UTSW 13 46825235 missense probably damaging 1.00
R1428:Kif13a UTSW 13 46791511 splice site probably benign
R1449:Kif13a UTSW 13 46812736 missense probably damaging 1.00
R1463:Kif13a UTSW 13 46929612 missense possibly damaging 0.75
R1541:Kif13a UTSW 13 46809213 missense probably benign
R1579:Kif13a UTSW 13 46752856 missense possibly damaging 0.93
R1582:Kif13a UTSW 13 46793922 missense probably benign 0.03
R1644:Kif13a UTSW 13 46793922 missense probably benign 0.31
R1752:Kif13a UTSW 13 46798409 missense probably damaging 1.00
R1755:Kif13a UTSW 13 46752613 missense possibly damaging 0.73
R1755:Kif13a UTSW 13 46773678 missense possibly damaging 0.50
R1858:Kif13a UTSW 13 46864838 splice site probably benign
R1891:Kif13a UTSW 13 46929219 missense possibly damaging 0.63
R1902:Kif13a UTSW 13 46788162 missense probably benign 0.00
R1928:Kif13a UTSW 13 46812745 missense probably damaging 1.00
R1960:Kif13a UTSW 13 46864838 splice site probably benign
R1961:Kif13a UTSW 13 46864838 splice site probably benign
R2016:Kif13a UTSW 13 46810799 missense probably benign 0.13
R2139:Kif13a UTSW 13 46752469 missense possibly damaging 0.92
R2174:Kif13a UTSW 13 46769176 missense probably damaging 0.99
R2407:Kif13a UTSW 13 46777097 missense probably damaging 1.00
R2504:Kif13a UTSW 13 46814200 missense probably damaging 1.00
R3122:Kif13a UTSW 13 46764596 splice site probably benign
R3499:Kif13a UTSW 13 46825339 missense probably damaging 1.00
R3905:Kif13a UTSW 13 46802690 missense probably damaging 1.00
R4474:Kif13a UTSW 13 46814155 splice site probably null
R4771:Kif13a UTSW 13 46825211 missense probably damaging 1.00
R4838:Kif13a UTSW 13 46826748 missense probably damaging 1.00
R4924:Kif13a UTSW 13 46929599 missense probably damaging 1.00
R4931:Kif13a UTSW 13 46809055 missense probably damaging 0.96
R4980:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
R4992:Kif13a UTSW 13 46777163 missense probably damaging 0.96
R5054:Kif13a UTSW 13 46802646 missense probably damaging 1.00
R5141:Kif13a UTSW 13 46752721 missense probably benign
R5329:Kif13a UTSW 13 46775401 critical splice donor site probably null
R5429:Kif13a UTSW 13 46772769 critical splice donor site probably null
R5499:Kif13a UTSW 13 46832736 missense probably damaging 1.00
R5509:Kif13a UTSW 13 46752115 missense probably benign 0.13
R5594:Kif13a UTSW 13 46752862 missense probably damaging 1.00
R5921:Kif13a UTSW 13 46825300 missense probably damaging 1.00
R5964:Kif13a UTSW 13 46771524 missense probably damaging 1.00
R6115:Kif13a UTSW 13 46801313 missense probably damaging 1.00
R6317:Kif13a UTSW 13 46826757 missense probably damaging 1.00
R6318:Kif13a UTSW 13 46815207 splice site probably null
R6393:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6394:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6395:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R6735:Kif13a UTSW 13 46752746 missense possibly damaging 0.76
R7037:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7038:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7039:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7237:Kif13a UTSW 13 46809156 critical splice donor site probably null
R7285:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7286:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7287:Kif13a UTSW 13 46752455 missense possibly damaging 0.95
R7341:Kif13a UTSW 13 46826745 missense probably damaging 1.00
R7693:Kif13a UTSW 13 46750613 missense probably benign 0.01
R7761:Kif13a UTSW 13 46798479 missense probably benign
R8098:Kif13a UTSW 13 46815304 missense probably damaging 1.00
R8171:Kif13a UTSW 13 46778968 missense probably damaging 1.00
R8271:Kif13a UTSW 13 46752581 missense probably benign 0.01
X0013:Kif13a UTSW 13 46929270 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CAGTTTCCTGTTGCCATGAC -3'
(R):5'- ACTATGTCTGACTCTCAGTGTGC -3'

Sequencing Primer
(F):5'- GCCATGACTCACTTTGCACAGTG -3'
(R):5'- GACTCTCAGTGTGCTCTCCTG -3'
Posted On2016-06-15