Incidental Mutation 'R5047:Fam186b'
ID394427
Institutional Source Beutler Lab
Gene Symbol Fam186b
Ensembl Gene ENSMUSG00000078907
Gene Namefamily with sequence similarity 186, member B
SynonymsEG545136
MMRRC Submission 042637-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5047 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99271018-99295888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99280686 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 253 (E253G)
Ref Sequence ENSEMBL: ENSMUSP00000104728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109100] [ENSMUST00000230608]
Predicted Effect probably damaging
Transcript: ENSMUST00000109100
AA Change: E253G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104728
Gene: ENSMUSG00000078907
AA Change: E253G

DomainStartEndE-ValueType
Blast:FBG 12 193 1e-19 BLAST
low complexity region 354 363 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 789 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230608
Meta Mutation Damage Score 0.1715 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.5%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of the FAM186 family, however, its exact function is not known. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,770,438 A526D probably damaging Het
4930503E14Rik A T 14: 44,169,241 M117K possibly damaging Het
Adamts13 G A 2: 26,996,910 A1020T probably damaging Het
Atg3 C A 16: 45,178,232 D132E probably benign Het
Blzf1 A G 1: 164,306,468 M4T possibly damaging Het
Cdon G A 9: 35,478,639 R863Q probably damaging Het
Cyp2d40 C T 15: 82,760,259 R255H unknown Het
Evi5 T C 5: 107,821,874 K57R probably damaging Het
Fcgr1 A T 3: 96,285,884 F266I probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm10142 G T 10: 77,716,162 C119F probably damaging Het
Gpr63 A G 4: 25,008,202 S309G probably benign Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Jmy T A 13: 93,441,572 H696L possibly damaging Het
Kif13a T C 13: 46,788,085 H972R probably benign Het
Lama1 C T 17: 67,743,281 Q296* probably null Het
Lmf1 C T 17: 25,631,838 probably benign Het
Lpp T C 16: 24,971,846 C352R probably damaging Het
Ltbp1 T C 17: 75,292,886 probably benign Het
Maml3 G T 3: 51,690,841 D807E possibly damaging Het
Mdc1 T A 17: 35,847,844 V372D probably benign Het
Mst1 C A 9: 108,084,309 H579Q probably benign Het
Olfr1238 A G 2: 89,406,713 V122A probably damaging Het
Olfr26 G A 9: 38,855,289 V76I probably benign Het
Olfr398 T C 11: 73,984,378 T77A probably damaging Het
Olfr739 T C 14: 50,425,239 F240S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Phlpp2 A T 8: 109,913,619 H472L probably benign Het
Plscr3 A G 11: 69,850,091 probably null Het
Rab7 A T 6: 88,005,223 probably null Het
Rad50 A G 11: 53,674,696 probably null Het
Scgb1b20 A G 7: 33,373,312 probably null Het
Scn9a A C 2: 66,562,480 L256R probably damaging Het
Spag1 G T 15: 36,195,442 Q260H probably damaging Het
Tatdn3 T A 1: 191,046,278 I239F probably damaging Het
Tcof1 A G 18: 60,831,914 S578P possibly damaging Het
Top3b A G 16: 16,891,418 T657A probably benign Het
Tstd3 A G 4: 21,759,621 probably null Het
Ttc4 A T 4: 106,668,238 L233H probably damaging Het
Vmn2r-ps130 T A 17: 23,063,820 M158K probably benign Het
Yeats2 A T 16: 20,208,465 Q822L probably damaging Het
Zfp976 A T 7: 42,613,419 C331* probably null Het
Other mutations in Fam186b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Fam186b APN 15 99280318 missense probably benign 0.00
IGL01729:Fam186b APN 15 99280251 missense probably benign 0.02
IGL01948:Fam186b APN 15 99280446 missense probably benign 0.00
IGL02133:Fam186b APN 15 99273703 missense probably damaging 0.96
IGL03010:Fam186b APN 15 99280627 missense possibly damaging 0.80
IGL03371:Fam186b APN 15 99280377 missense probably benign 0.00
R0457:Fam186b UTSW 15 99271285 missense probably benign 0.02
R0522:Fam186b UTSW 15 99280519 missense probably benign 0.00
R0571:Fam186b UTSW 15 99286953 missense probably benign 0.02
R0620:Fam186b UTSW 15 99280128 missense probably benign 0.34
R1575:Fam186b UTSW 15 99286971 missense probably benign 0.00
R1883:Fam186b UTSW 15 99278798 missense probably damaging 0.96
R2144:Fam186b UTSW 15 99280657 missense probably benign 0.00
R2267:Fam186b UTSW 15 99285643 missense probably damaging 0.99
R2332:Fam186b UTSW 15 99280428 missense probably benign 0.42
R2394:Fam186b UTSW 15 99280177 missense probably benign 0.01
R3624:Fam186b UTSW 15 99280515 missense probably benign 0.01
R4681:Fam186b UTSW 15 99280890 missense probably benign 0.00
R4811:Fam186b UTSW 15 99280237 missense probably benign 0.01
R4906:Fam186b UTSW 15 99271321 missense probably damaging 0.99
R5028:Fam186b UTSW 15 99280801 missense probably damaging 0.99
R5295:Fam186b UTSW 15 99283874 missense probably damaging 1.00
R5440:Fam186b UTSW 15 99273853 missense possibly damaging 0.75
R5468:Fam186b UTSW 15 99278870 missense possibly damaging 0.93
R5596:Fam186b UTSW 15 99271289 missense possibly damaging 0.90
R5759:Fam186b UTSW 15 99279717 missense probably benign 0.09
R6239:Fam186b UTSW 15 99280434 missense probably benign
R7117:Fam186b UTSW 15 99285590 missense probably damaging 0.98
R7141:Fam186b UTSW 15 99283892 missense probably benign 0.03
R7223:Fam186b UTSW 15 99279837 missense possibly damaging 0.77
R7301:Fam186b UTSW 15 99278748 missense probably benign 0.00
R7441:Fam186b UTSW 15 99280089 missense probably benign 0.00
R7614:Fam186b UTSW 15 99286986 missense probably damaging 1.00
R7825:Fam186b UTSW 15 99283847 missense not run
R7853:Fam186b UTSW 15 99280747 missense probably damaging 1.00
R8340:Fam186b UTSW 15 99279714 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGGTTCTTCTGGACCACTAG -3'
(R):5'- AGATGCTCCAGGACAAGAAC -3'

Sequencing Primer
(F):5'- CACTAGCAGGCTGGGCTATATTCAG -3'
(R):5'- TCCAGGACAAGAACACCGC -3'
Posted On2016-06-15